Description :
From Genome Similarity Track
Location :
Scaffold_335:27262- 28777
Transcript NameFunction/comments
g18038.t1hypothetical protein
g18039.t1hypothetical protein

Sequence
1515 bases(100 bases per row)
CAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCCCGGTCTTCTTCACCGGTCGGCTCTTGCGCTTGTTGTCTCTCGTCATGAACGCTTGACCTTGGCCGT
GCGCGGCTCCGTCGACGCCGCCGCCATCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCACACGACAGCGAGTCGGCTCT
CGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCG
AGCTGCTCCGCTAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTGGTGAAGAAACGCCGACGAAGAAAGAGCTTGT
TGGCCAAACTCTTCTTTTCGAAGTGTCCTTCCAGTCTGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAGCTGCGAGTCCTCCATCGCGAGACAG
ATGATCGCCAGCGCCTTACGCGCCTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTCACTTCCCCACTCGTCACTTCCCACA
GTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCTGTTGAACTTGTTGATGCGGGCGGTCGTGGTCGGGGTGGCGTC
CATGGCGAAGGCGTAGTCGGGGTCTTGGTCTTGGACAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGCTTTGGTCGGTTGATGGCAAAATGCAAAGT
GATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAG
TTGCTTCAACCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAACAGCGTCCCA
TCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATACGGC
AGCTGCCCGAGGCGCCTTCTTGACAACAGTATCGTGCAGAAGTTCACTCCGCCGTTCACGCCTCAGCTGAATGGAGTGGCCGAGCGGATGAACCGGACGT
TGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGATTGCCCAAGTGGTATTGGGGTGAAGCGGTGATGACGGCTACGTTTCTCCGTAATCGGTGTCC
GACACGCGCCGTCAGCCACGACAAGTCTCCGCACCAAGTTTGGACTGGCAAGAAGCCGCTGCTGGCGAACCTGAAAGTGTTCGGTTGCCACGCGTATGTG
CACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAAC
TGGAGAGCAGTCGCG