Description :
From Genome Similarity Track
Location :
Scaffold_381:2726- 4763
Sequence
2037 bases(100 bases per row)
CACATCCTCTGGGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCTTACGCCTTCGCGGGTAGATTGAGCTACCTGAATCCTCT
GTGCGCCCAACGTTTGATCCACGATGGACCGAAGTGAGTTTCCTCGCTTGAACGACTCACAGTACGAGTCTGTTCGGAAGATGGGAGACATCTTTGGACA
AGATGTCCTTCGCAGCTTGGCGGCGGCGACGCCTGCCGAGCAGCAAGAGCGCATGACCGCGTTTGAGACCTACGAGCGTGGTCTCATCGCTCACGTCCGC
GGGAGCTTGGAGGCCACGATGGCCGCTCCCCAGGCAACCAGGCCTAAGCCGGTGTGGCTGAAGGTCCCCGCGTTTGAGGGGAAGGAAGGAGAGAACCTTC
ACTTCTGGGTCCGTGAGGTGGTGATCGCCATGAAGGCGGGTCTGATCTCGGACGAGCCAGTTCGGGTGGCGTTTGCCCTGTCCAACCTTGGTGGACGTGC
CAAGCACTGGGCGTACACTAGGGAGACGACATCTCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCGTTCCTACCGGCGAAC
AACGAGTTCCGCCAGCGCTCACGCTTTCTCGCGTGTAAGCAAGGTAAACGTGAGCTGCAGGAGTACGCGCAAGAGATGCGCACTTGGTGGCATCTCTGGT
AGGAAATCCTCTGCCTGAAGACGTCAAGACAACAGTCTTCATGGACGGCCTGAAAGTCGGTCCTGCTCGCACCCAGCTATTCCGAGTGCAAGCGACAACT
ATGGAGGAGGCGATTCGAATCGCCCTCCAAGAAGAGTACAGCCACAAGCAGGCTGGTACTCCTCGGGAAGAGGAACATCGCCACGATGAGAATGGCGTTC
CTCGGGAGGCGGAGCATCGAAGCAATGACGCTGTTGCTCCTGCTGTCACGCAGCCCGTTAATGCCGGTGCGTACAGCGAGCCCGAACCCATGGACTTAAG
CTCAGCCGAGAGCTTTGTCCGCTGCTATGGATGCGGCGGACATGGACACTACCAGCATATGTGTCCCTCGTCAGTCCTCGGGAAGAGAACAGCCCCGTGG
GCACCAAGTCCGGTGGCGCAGGCCACGGCCAGGTGGACGAAGACTCCCCAGCCACCAGTAGAGGCGGTATGCCCTACTGAAGAGCGCTAAGTCTTCGTGA
TGGGTGTGCAGGTTGTGCACACCACGGGATTTAGCCCAGAGAGACGTGGTTCTCTCAAACCGGTGAAGGGCAGTGCTGGGCTGCTGGTAGTACACTCAGT
GTACGGGTGTACGATACCCCTTGAACGTTTGATGAGTTCTGGGGCGTTGATACGCCGCCGGAACGTCGCTTGGCATAGCGACATCCGACTGCACTCTATG
TCAGAGTGGCGGTCGTGGGCTGGTCCTTGGTGGACTAGCCTTTGGTACGGCAGTATCAATGGTCCTCAACGGACCTGAACGTTTCGGCTCGATGAGCTCG
CGCACCGCGGTGTCGCTCGCAGTTCTCGCCATGAACAACATGGATGTGCCGAACATAAGGCACAGCCCGGACTTTGGTGTGGCAAGGCTGAGAAGGGCCT
ACCAGTCCAGGTCTATGACGGAGCATTGGTGAGTCATGTTCTCACCTCCGTCATGACTGGGGCGTCTGATACAGACCGCCAGGACGCAGAAGCGTCACGG
AGCTGTCAACGCGCCGACAGCTCTGCGTACAGCAAGACCATGCTCTGCTGCGGCAATGCCACGGGCGTGGGTCTTTTGCCCGGCGTGTGGAACTGCTACA
CCAGCAGCGTCCAACGCCGAAGGTCGTCGCGCCGTACGGGCTTCGACTGTGGTTATGCCTTTAAGCGCTAACCAGGTGGGTAACTTAGAAACACACGGTC
ACCCAGACCTTAACTGAAGAGGAAGGCGCTGAATGCGCTTCCTGTGTGGATAACACAGTACCACACGCAGTCGCCCAGACTATCACTGAAGAGGAAGGCA
TGACCGTGCTTCCTGTGTGGGTAACACAGTACCACAC