Description :
From Genome Similarity Track
Location :
Scaffold_89:272594- 275794
Transcript NameFunction/comments
Hyaar_Emoy2808858ankyrin repeat domain 52 (predicted)

Sequence
3200 bases(100 bases per row)
AAAAGTCTCGGTTGCGTCCGTAACATCTCTTTGATTGATTGTGACCATGTCCGCCGCCAGTCCTAAACCTGTTGACTCGAGTCTAGCCGACATTGTCCGA
AAAAGCCGAAGCGCAAGCGACGTGTCGCCCACGAACGCATCCGACTTGGCGGTTGATCCGAACGATTCAAAGGGCGAAGGAGGGGATCCTCTAGATTGTT
TTCTGGTTCAGAGCGACGATCCGGTGGAAGTTGCAACTGAGCGAGAAGGGGCGAAGGAGGACACGGAGTGTTTCAAGGAACGAGCGACGGGAGAGGACAT
TGTCGAGGCGGCGACAGGGGAGCTGAAGGAGGAGAAGTGTACGGACTGCCCCAAGACGGAGGACAGACCAGAGCTGCTGGCTGAAACGCCTTGTGGCGAC
TTGGAGAAAGAGGAACAGAAAGGGGAGAAGGAAGAGGTCAATCAGCAGCAGCAAGAGCCTTTAGCCCGGCTTGCAACTGCGAGAATTGCCGAGTCGAGGT
GTATTTCGCGACGCCCGTTTGTCCCATTGGCATCCAGGAGCTGGCGCGTGCGAGCGATGGAGTCCAATTCGCAGATTACGCGTCTGATGAAAGCCGCGCT
GCTTCAGACGCTGCTGCACGCTATCCGTACTGGATCGGTGGAAGGGGTGAAGGTTGCAATTGAGCGTGGAGTGCAGGTGCAGTATCTGGACAGTCGCCAG
CGCAACCTCGTCATGCTGGCAACCAAGTGTGACACCGATGCTCGTCTGCGCATTGCAATTATTTTGCTGGACGCTGGATGTGATATGAACCACAAGGATC
TGCTAGGCTGGAGCTGCCTGCACTACGCTTGGTACGCTCGAGAACCCTATTCGTTTTGAGTACTGAAGACTAACGACCATGTATGGATGTGAACTTTGAC
TGTTTTTGTTGTTATAGTGCAAGCGGCGCTAGCGATGTGGCCACAGAGCTCGTTCGTCGAGGAGCTCGCGTTGAGTTTAACCCATACGGCTACGGTCCTG
AAGACTTTAACATTCCCAAGGTGGCGCATGCAAAGAGTCTGTTACAACACACGGAACAACTACAGCACGAGCAAAATGTCTGCTCTGCTTGGGCGTACTT
TCGTCGTCAGGCAGAGAAGTCTAACTTCAGCGTAAAGTGCAAATCGGTGAGCAGATGGCAATAGCTAGTCGTATGGAAGTAATATGGAGACTGATGTACT
CGCGTTTGCTTGTCTGCTTGTTTGTAGAACTGTGATCTTGGCAAGCCTTTAAAGATCACGTTCCAAGCTCCTGCAGGACATAGTCTCCTGGACCGTATCC
GCGTGGTTGACATGAACTCGGATGTGGCTCTTTGGCTGCAGGTCTCCAAGACCTTTAGTATTCCCGCCGGTGATGTGGGCTCGATCACATTAGATGTCGA
GACGCTGGATCGCCCGTCGCTTTATCGTATTGTGTACGAGAAATACGAGCCGATGCCTATCCATCAGCAGCAACCAGCAGACTCGGGCGCTGACAGTAAT
TTGTGCGTCAAAAATCTGGATACAGGAGCGACACTGTCGATGGGCAGCGTCAACACGTTGGTCTTAAAGGAGCTCAATAGCTCTCGATCATCGAAGAGTT
CAACAAAGCTGTCGAGTTCATCCAGGTACGCAAATGTCAAGGTGTTCCTTGACCGGTATGGAGTACTGACAATCACTGTGTGTTCACTATAGACCAGCGC
CCAAATCGGACAAAGCTGCGACCATGGTGCGACGAGGATCGACAACGTACGTCTTTACTTAGCTAAGCCATGCTGCGTAGCATGTATTGTCGATAGGTAA
CTCAATGTTGTTATTCATGGTAACAGTCGAGCACGCGAGATCACTCAAAGGGTGTGCGAAGCGACCGTAGAGGAAGACGATGAAGAAGAAGACAAAGATG
CTGACTTCTCAGCCGGTGACACGCTTACAGCGCAGGTGATTGCGGAGCACCCAGCGGTGACGAGTATTACGGGCGTATACAAAATCGTAGCCATGGGGGC
TGTCAGCATTTCAACGATGAGAACTGCCAAGGCGAATGAATATGAGATCGCTATCCGTGATAAGGGCCCGCTTGGTCTCCAGTTGGTACGGTTGTCGTCT
TGCTGCTCGCAAAGCCTCATGCGCCATTGCATCTGATGACCATCGTTGTTTTGCGTGTGCAGGCGCCAAAAATCGATGGTTCGAAGAGGTCCCCGCGTCT
TATTGTACGACGGAGCCAAGGCCAAACGGCGGCCGTGAATCCAGGTGATTGTCTTGTTGCAATCGGTAACGCAAACATTGAGCACGCTGGTCTCAAGCAC
ACGCTGTGGGCACTGAACGACGCAAAGCGGCCGCTCGTCCTTCGCTTTCGACGCGGAAATGCGAAGGAGAAAAGAAGTTTGTTTACGGCCGGTCTGCTTA
AGTTTACAGGACCTCATAGACATCCCATTATTGCGGTGTAGTCAGTCGGCTAGGTGCAGCTTCTCGTTCCGCTAATGAATTTGCATTTCTTGATGGGGTT
GGCCCATCAATAGTGCGAATCGATTTCGAAAGTCCGCTCGCTCTACAAAGCAGTCAATCTTGTACATAACAATGTAAGCTCGTCGGCTCACAGTGGCGAA
GCTTTACTGCGCTACAACATGGGATGTCCTCTGTCTACATGACAATATCCAAAAGTCCTGTTTCGGCTAGCACATCGTGTGCATAATGCTCCGGGTTTTG
TTGACACGTCAATAACATGCAGCGGATGTGTCTACCCATAAATAAGCAAAAGTCAACACGTCAGACACGTCAGACACGTCATACTTATGCAAAGAGCACA
AAAGAAACTCACCCTAAAGTGTTCAATCAAATCACCTGGGCGCACGTGTAAATGAGCCTCTGTCTCGGGATCAAACACGGTTGCCGGATCTGCAACAGCA
ATCGCGTGACAAGTAGTAATTATCTGAAGATGTCACTTAAGCTGGGGCAAAAGGTCTCTTACATTGCTTGCCGTCACCGCGCCAAAGATACCAAGCTTGC
GCTTCCCACCACGCTGGTTCTAGACATCCTGCGTTTTTATACTATTCGTTCAGTGACATCGAAACCACATCGTCAATATTAGCATGGTAGCCCGCCTATG
TCAAAGAAAGAAATTATAAGACATAGCAACTTACGGCGATCGCTAGCAAGGATCCAGGCCGTAACGTGCTCGCCCACGACTTCACGTGCGTTAAAAAGTC