Description :
From Genome Similarity Track
Location :
Scaffold_41:27255- 28832
Sequence
1577 bases(100 bases per row)
GGGTTTGAAAGAGGCGGTAGAACCCATGTGGGTAACAACTCGCACTCTCCTGACCCGAGAACCCATGTAATGGGGAGCCCCATTACAATAGGTGTGTTTT
TTGAAAAACTACGATGCTGATTGTGGAACGAAAAACATCAATCTGAATCGTTTTCAATAAGGCCCATTTTGACCAATTTTCACGCTTCAAAGTCAATTAC
TGACCAAAATTTCGCAAAAAAGTGGGTGTCCCATAGCACTGACCAGCACTGTAAATGCATGATACACTCATATCTGCATCGTTAAATGAAAGGGCCAGTG
CATATACCAACCATACATTTATGCCAGTAATTCCGTCGGCTGCGCTCAACAACTTGCTATGCAAAATTAGACTAGAGCTCGAGTCAGAATTAGTTCGTGC
GCTCCTTCGACGTCATACACATGCATGTACTCCACGCTCTAGTGGCCTCCTGCTGTTGCCACAGAATACTGAGCCTTCTGCGCTCCACCTGGCGCCACCA
CGTACATTCTGCGCCGTGTGGCGCGCTTCCAGCCTTCTGCCCTGCGTGCACGTCACACACGTCGCGTATGAGCTAGTCGCTTACCGCGCGACAATCACTG
CGCCGGTCACGACCGGCACACACACGCATACAACAAGGCACACAAAGCTCATGCACTTCCCATTCGCTGCTTACTTGCTAGCCTCGACTGCTTGATCGCG
TCAGACGCTGCACACGCCACGAGGACGCGCGTGATCTTTGTGGGCTTGGCACGCGCCACAGGCACGTGCACGCTTCGATATTTCGTCCCGCGGCCCATCA
CGTGGTCGGCAACTCGCTCGGGTTGGCCTTGGTCACTCTGCAGATCGGTACCACTCGAGCAGGGTGACGCCAACAGTTGCGCGCGGTTTCGAGCGCTGGG
GTTACTGCCTATTTTGTTCCATCAAGTTGGGTTTGGCCGTTTACTGTGCATTGTCGTATATTATTTTGTCGTTTCTTTAGCCTCTCCGTTCTAGAACACT
TGTGTTATTGCTGCATCTTTGGGATGTGAGGTTGGGAAGGTTCGTGTTCAGTCTCCGCGTGGTATGCTTTTAACAACACTCAGACTGCGGATAGAGCCGC
TGACTTCATTTTCCGCAAGATGACCTCTGACTGCAAGCCGCACTTTGAAAAACGTCACCGCAAGCGCATCTGTCACCCAGCAACAATGATGAACTCTCCA
TTTGACTCGAAGCTATTGTGGAGGACACTTACAAGGACACTCCGACCGATCCCCGACTTGAAAAGCCATCGCCCTTGAGCATCTGCCTCTACCCTCCTGT
TGAAGCCGTCGTGATTTGACAGTGTGATCAGTTATGAGCGCGACCAGCACACCGACCAAGTACATTCAAGCTGTCTAAAGAAAGCTGTGAGTGTGGAATG
CCAGGATGCACTACAGCAGATGGCTGACTTTTCACTTGGGAGCACGGAGCTTATGGCACTCTAAGTGCTTATTCACAACTCGACGGAAAACATAATCCCA
GGAACGACCGACTTGCAATCGTTGAGAAAAGCAACAACCAAGGTCATGGAAGATGGCTTTGTTGAGGTACAAAAGGA