Description :
From Genome Similarity Track
Location :
Scaffold_223:27255- 28292
Transcript NameFunction/comments
g11678.t1ETO85361.1 hypothetical protein F444_00882 [Phytophthora parasitica P1976

Sequence
1037 bases(100 bases per row)
GGAAGGTCGATCTCGGTAGTGCCGACCTGGAGCTCGCCGATCTGCCGGTGGTCGTACCTGCCCTACAGAAGCAGCAAGCTTCGCTACAATATATTTGCGA
GTGGAAGGCCATGCCCTCAACGTCTCAATACTCGACACCTCTTGAAACGCTGTACGATGTCTACGACTTCATCGGCGCTGAGCTTTCAAGCGAGCGTATT
GAACGCAAGCTGATGAAAGCTGCAGAGGAGCACACGTGGGTGGACGGCGATTTGGACGATGGTGGATCGAGGACCTTTTTCGAGTTGCAGAGCGGTGGCT
ATGAATGCTTCGATGATGTGGACATCGTGGCCAGCAAGACCTTTGTGCGTGGGTTGGTGCTCTTGGTAATCTACTACCAACGTAGTTTCTACGTCGTGCT
GCAGGAAGCAGACGGCGAGCAGCCTCTGCTCGATGTGCGTTTCCCGGACCTCTCGGCTCACCTTCAGGGCATCCACTTGCAGACATACCGTGAGGACGAC
TGCAGCAACATGAAAAAGCTCACGCTGTGGCAGGCGGCTAGTATCGGAAAACACAAAAGCCCACCGAAGCCACTGAAAGTGCAATGCAAAGATGTCAGTG
GCACAGGTTACAACCAGACCTTCCTCATTCGGCGCACCCCTCGTGCTGAAGGCTCCACAAACACCCCGAGTTTGCGCGAGGTGCTCTTCCGATTTGGCAA
CTGGTGCTACAACGGGCACGTGGATCTGGGACCAAAGCTTGAGTTGTCAGACATTCCTATCATCATCCCCATGCTTCGACGACAGCAAAGTGCTCTGGTA
ATGTTCGAGTGGTCAAGTTTCATTCTGCTCGCGGTGTTACTCATCGTGTGTCAATTTTGCTTTTCGTAGACCTTTATGTGCGAAGTCTCCAAGATGCCAG
CGACATCATTATTTACCCCGTCGATGGAACACTTGGCAGGAATTGTGCCTGCCATGCAGGAAGAGATGTCCAAGGCAGAGCAATTCGTGCAAACACTGGC
TCAAACTGGGGGGTCGTTCGTCAAGAGCCCGGGCAAC