Description :
From Genome Similarity Track
Location :
contig_28:272522- 273871
Transcript NameFunction/comments
g6949.t1XP_009513885.1 hypothetical protein PHYSODRAFT_248285 [Phytophthora sojae

Sequence
1349 bases(100 bases per row)
TGGTCCACCTCGCAGATGAACCTGTCGCAGTACAACGACACGGACGAGTGCAATGCTCGCCCCGTGGCCGACGGCACATGCCTCATGTTCCCGGGCCACT
CGAAGCTCGAGTGGACGTTCGCCGTGAACGCGTGGATCTTCGGAGCCATGGTCGGGTCGCTGTGCTGCGGCCACTTCAGCGACAAGTACGGCCGCAAGAA
GACGCTCATGGGCAACTGCCTCTTCATCATCGTGGGCGGCGTCGTGCAGACGGTGGTGTCCAACATCTGGGTCTTCTCCGCTGGCCGCCTCATCGCTGGC
CTGGCCTCGGGCACGGCCACGGCCACCATCGGTAGCTACGTGAACGAGTTGTCGCCGCCGCACATGCGCAACACGCTGGGCCTGGGGCTGCAGATCTTCA
CGACCATCGGCATTTTGTTCCCGGCCATCGCCTTCTTCTTCGCCAACACGAGCTCTGGCTGGCGCTACCTGGCTGCGTTCCCAGTCCTCCTGGGAGTGAC
CTACCTGCTGCTGGCGCCAACGATGTGCGTGGAGAGCCCGGCGTGGCTACTGACGCACGGACGAAGCCAAGCAGGTCATCGCCCGTCTGTACGGCGAACA
GCATGTGCAGACTGCGCTGTCGTGGCTGCAGGTGAAGCGAGAACGCCGAGGAGGGGCTGGCTGCTCCCGCGAAGGAGTCGATGTTCAACCCGCGCTACCG
TCTGCAGCTGCTGGGCGGCGTCCTCTTGTCCTGCGCGCAGCAGCTCTCGGGCATCAACGCCGTCTTCTACTACTCGGGCAGCATCTTCTCGGACGCCGGC
ATCTCGGACTCGCGCGTGGGCACGCTCATCATCGACTTCATCAATATCTGGCCCGCCTTCTTCACGGGCGTGCTGGCCAACCGCTTCGGCGCGCGCAACA
TGATCCTGTGGGGTCTGGCCGGCATGGTGGCCATGTCCATCGGCATGACGGTGGCCTTCATCGTGGACGTGTCTGCGCTGTCGATCGTGTTCACGGCGCT
GTACGTGATCGTGTTCGGCGTGACACTGGGCCCGCTCGTGTGGGTCATGACGGCCGACATTTTCCCGGACTCGATCCGTGCCAGCGCGTCGTCTTTCTGC
ATCGGTATCAACTGGCTGTGCAACCTCATCGTGGGCGTGTCGTACCCGTACATCTCGGATGCTCTGACCGACTACGCGTACGTGCCGTTCGTGGTGCTGC
TGGCGATCTTCTACCTGTTCGCTCTGAAGCTGGTGCCGGAGACGTCGGGCAAGTCGGCCGAGGAGATCCAGGCCGAGTACGATTCGCGCCGCGAGAAGTA
AGTGCCAAGTGTAACCAGTCAAGAGATAGCGTGCTTTCGAGCGCATGGC