Description :
From Genome Similarity Track
Location :
Scaffold_1129:2725- 3726
Transcript NameFunction/comments
g16794.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
GTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAAGCAGGACAAGTGCGGGAATCGAAGTCAC
CGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACCGGGCGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGGTACCGGCACAGAC
GCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAATACTCTTGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGT
GAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGACTCGTGATGTCGCAGGGGCTGAAGAACGCCCCCGCGACGTTCA
ACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGTAAATCGGA
TGTGGGGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGTCGACCGAG
ATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTGAAGG
AACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAGAGGCT
GCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCCTGGCGGTGGCCGACCAAGATCCCCATT
CCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGGAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAG
C