Description :
From Genome Similarity Track
Location :
Scaffold_1313:2724- 4591
Transcript NameFunction/comments
Phyra_72463heat shock protein 70

Sequence
1867 bases(100 bases per row)
TCGGCACCAGGGGCGCCGCCAGCAGCAGCGTACATCTTCTGCAGGATCGGGTTGGCAACGCCCTCCAGCTCCTTCTGCTTGCCCTCGTACTCCTCCTTCT
CAGCGGACTGGTTGGCGTCGAGCCAGTTGATGGTCTCGGTCACCTTGTCTTCGATGGCCTTCTTGTCATCCTCCGAGATCTGGTCCTTCAGCTTCTCGTC
GTTGAGCGTGTTACGCAGGTTGTACGCGTAGTTCTCGAGCGCGTTCTTGGCCTCGATGCGCACCTTGTTGGCCTCGTCCTCCGACTTGTACTTCTCGGCC
TCGGAAACCATGCGGTCAATGTCGGCCTGGGACAGACGACCCTTGTCGTTCGTGATAGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCAACAGCCGACA
CGTTCAGGATTCCGTTCGCGTCGATGTCGAACGTCACATCAATCTGGGGAACACCACGAGGCATGGGCGGGATGCCGTCCAGGTTGAACTTGCCCAGCAG
GTTGTTGTCACGGGTCATCGAGCGCTCGCCCTCGAACACCTGAATGAGCACACCAGGCTGGTTGTCCGCGTACGTCGAGAACGTCTGCGACTTCTTGGTG
GGCACCGTCGTGTTACGCGCGATCAGCGTCGTCATGACGCCACCGGCCGTCTCCAAACCCAGAGACAGAGGAGTCACATCGAGCAGCAACAGGTCCTGCA
GCTTCTCCGAAGAGTCGTTGCCACTCAGGATGGCAGCCTGGACGGTGGCACCGTAGGCCACAGCCTCGTCCGGGTTGATGGACTTGTTGGGCTCCTTGCC
GTTGAAGAAGTCGGACAGAAGCTGCTGCACCTTCGGGATACGCGTCGAGCCACCGACAAGGACAACCTCGTGCACCTGGCTCTTGGACAGCTTGGCGTCG
CGCAACACCTTCTCCACGGGCTCCATGGTCTTACGGAAGTAGTCACCGCACATGTCCTCGAAACGAGCACGCGTGATGGTCGAGTTAAAGTCAATGCCAT
CGAACAGAGAGTCAATCTCAATGTAGGCCTGAGCCGACGATGAAAGCGTACGCTTGGCGCGCTCGCACGCCGTACGCAGACGACGGAGGGCACGCTGGTT
GTCCGTGATGTCCTTGCGGTGCTTGCGCTTGAACTCCTGAGTGAAGTGGTCCACCAGACGGTTGTCGAAGTCCTCGCCGCCCAGGTGCGTGTCGCCAGCG
GTGGCCTTCACCTCGAAGATGCCCTCCTCAATGGACAGCAGCGACACATCGAAGGTGCCGCCGCCCAGGTCGAAGATCAGCACGTTGCGCTCGCCGCCCT
TCTTGTCCAGGCCGTACGCAATAGCGGCGGCCGTGGGCTCGTTGATGATACGCAGCACGTTCAGCCCGGCGATGGCACCGGCGTCCTTGGTGGCCTGGCG
CTGCGAGTCGTTGAAGTAGGCCGGTACCGTGATGACGGCGTTCTTGACCTCCTTGCCGATGAAGGCCTCGGCCACCTCGCGCATCTTGATAAGCACCATG
GACGAGATCTCCTCGGGTTGGAACGTCTTGGACTCGCCCTTGAACTGCACCGTGATCTGCGGCTTGTCGCCGGCGCCCGACGTCAGCTTGAACGGCCAGT
GCTTGATGTCGGCCTGCACGATCGGGTCCGAGAACTTGCGGCCGATAAGGCGCTTGGCGTCGAACACCGTGTTGTGCGCGTTCATGGCCACCTGGTTCTT
GGCGGCATCACCGATCAGGCGCTCCGTGTCCGTGAAGGCCACGTAGGACGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATCTCCACGCGGTCGTTC
TGCCACACGCCCACGCACGAGTAGGTCGTGCCGAGGTCGATGCCGACCGAGTATCCAGACGTCTTCG