Description :
From Genome Similarity Track
Location :
Scaffold_125:2723- 9863
Transcript NameFunction/comments
Phyta_totarag4114hypothetical protein
Phyta_totarag4115conserved hypothetical protein

Sequence
7140 bases(100 bases per row)
CGGCGCGTGGCTTGCCCTTCAGAGATGGGACGTGATTTGTGTCCGACACTTCGGCGTCCTGCTTGTCCTCGCCATCGCCCTTCCGGAAGAACGCCACGAG
GTCGGCGAACACGTCAAAGCTCACCTGCATCAGAAAGACTGGCCGGTCACTACGCCGCTTGCGACAAAGAAATAATTCGACGTAATTTATGTAGCGAGTC
CGAGTTGGCACGTACGTTGAACGGGTAGGGCACCTTGAATCGCACGAGTGCCTCCGTGAGCTCGCTTGTCGTCACGCCGATGCCTAGCACATTGACCACA
CCCAgccgtgctggaagcagacAAATAAATTCACACGCAATAATGAGCGGCTCAATAGCTACTAATGAGGCAACGGTAGAGCACATCACACGTACTCTGA
GCGACGGACAGCAGCCCCCTGCCTTCCACGTCAGCCTGAGAGAACGCGGCCcagagcagctccatcgggtcgtccacctcgacaGTATCCCCaacgtcat
cgtcgctcaTATCTGAGCCGAACTGACCAAActcatcgtccgagtccttctcgtcttcaCCCTCCCCTCCCAACGCCTCCTCCCCCTCTTGCACTGTTTC
CATGCGTAGTCCAGGACTCATATCCTGGGAGCCACTATTCGCTTTCATCTCTCGTGCCTTTCGTCGAGCCATCTTTTTCCGTGCACGGGTCGCCTTATAC
GCGGCCAATACTTTCTTTTGCATCGTTAGTTCCTGTGCAATCACATCGGGCTGGCGAGGGTCGATAACCTTGTAGCATTCCTTGTTCGCTTCGCGATCCT
CTTGCCACTGCTCCCACTTGGCCCAACCAGCATGCATCTCACTCAGTTCATCTGTCGATAGCGGTTGAATCTCTTCGATCCGTCGCACCGTCGtaaattg
ctgctgtgcaaaTGTCTGCTTTGCCTCAGTGAAGTAGCTCGGAAGGCACTTTCCAGCGGTCGCTACGGGCCGTTGAAGGCCCAACATTTCCTCGTGGAGT
TTGGGGTCATTAAAGAGGGGCTTTGGATGTCGAGAGACTTCCCCAGGCGCATGCAAACGGCGCAGGAAAATATGATGTCGTGGGGTCGATGGCCCTATGT
CTGTCTCTTGGCTTTCCGATGCTGCGCCCTCGAGGTATTCCGCAATATCTCGTGGTCTCAAAATTTCTACCCCCGTGCCATCGCCGTTGAGAACGAAAAT
GTGGGGCTCAATAGGCTCATTAATGACTGCTTTTGCAGGGATGCTATCGACGTCGTATCGAGCGGCTTCTACCTTACTCACTACTCCAGCGAGATCAACG
AAAACAGTGGGCCCCGCTTCCTCGTCTGTTCCATTAAAATCCACGTGAAATTTGTTCTGCTCGCTATCGCAAAGCTGAAATTGACCGTGGAGGCAATCGA
AGTAGTAGACACCATTGTGGCTAGTCACATCTcgatcatcgtcatcttTGGAGTCAGCCTTGTCAGGCGCACTGCTATTTAGTGCTGACcctggtacatg
tagctttgAGGTATATTCCACTCTTCCACTATCTTTTGCGACGATGATTTGTCCACTGGGCTTTCGAGTTGTGACCCGGCCGTTCACCTGTGCCGTGACC
TTCGTGTTATAGCTGATCTCGACGCACGTTCCATCATAAATGTTCACAACGCTGCGTATACGTAATCCACCCTTCGTAACTGCGACACGCTCCCCTGCAG
CGTGGTGTTGGGCTGTCATATTTACTTCCACATCGATGCAAACATCAGCAAACCCTCGCTTCTTCACGAGTACATGTGTGCTCCCAGCATTCGTGTACAT
TCGCGTGCCATCCACATGATACGTCACGCGGGCACCACTCGTGAAAGTGACAATCATGACGCCGTTGGGGCGTCGTTCGACCAGCGCATCAGTCTCTGGA
TCTACTGTGAGCGTCGTAACTAGTGGCGGCTGAAGTTCGTTGTCATGCCTAGTTGACTTTCTCGAGCTGTAATGGTGTCTCTTGCAATCACGAACAACAT
GAACGATGCCACTTGCTAGCATGACTTCTTTTCGCCCGCATTGAAGCACCCGTAGCACGCTTCCCTTCCCGTAAACCACTCGATACTTTTCCCTTTCATC
ATGATCTTGCACCCCATTTCTTGCTACTCCATCTCTCGCTTCGCGGCTAGCCTGGTGACCCCGTTTGCTACCAGTACCGCTGTTACACCCTTCTATTGCG
GTTTGAGCGTACCGCTGAACGATAGAGCCGTCAGAGCAAGCAGACACAATCAGACCGTTCGGGAACGAATTGGTTACTGCGACAGTGGAAAACTTGTCCG
GTTTTTTCGGTAACCTTCTTCGCCCCTCGGAGATATGAAGCGAAGACTCATCTTGAAATGCTGCCACAAACTGAACGACGCGGGGCCCTGGAGCTTGATT
CTTGTATTCGTTGTACTTGCGTTCTTCACCTGCAATACTCCCCGACCGTAGGCCAAACGTTTCCCTGTTAACGATATAGCAGTTAGTTAAAGCAAAAACA
AGACATGAGTGAATAATATATGAACGCACCCGTGATGGTAAACGGTGAGCCATACCAACCCGCGAGGTGTTTGATATAGTCGTACTACGCTGTGGTCAGC
CGGGTACATCGACCAAGTTTGGTTTGccacgagcgcgagctgTCCAGCAGACAATGGCACACAtgcacacgctgcagcttcagtgCGTGGGGTAAGATAT
TCCTGGGAAATTAGCTGTTCACGCTTCCAATCTTTGAATGCTGATCGATGACGCACGTGATCACTAGCTACCCAGGATGACGATTGCATCCGACCAGGTG
CCGTTTTCGGAAGACACGCCAACAAGAGTGAGTCCGTGGGCGCGTAGTAACTTGAATAAATATCGGGTGTATTTTGCTGAAGCACGAATGTGATTCGTTG
TGGAAGAACAGCACGCGTCAAATTCTCAAGGAATGCACGAGGCTGCAATTTCCCCCGCCACGAGCTGCCTAGTatttcttcgacttgtaAGAGCTGTCGT
GTTAGATGCACCACCCAGCAGCTAAGCCGTGGCGACTCGTAAAACGTTGCCAGCTCCGTATTGCGAACACTGCGCTCCGGCTTGGATAGCTCTGGCACCC
GAGGCATCGCCTTCCGCCCTTCATTGCCAACACCTGGGAGGTCACTTTGCCTCCACATGAACCTTTCCACATCATCCAGGCGGTGATTTCGTCGAGGAAG
AAAGGATGGGTTCCCTTCGGCATGCAGTGCTTCATGGCAAAGCTGAGCAACCGCAAATCGACACGCCACTAAGTCGCCATGCTCAACGAATTCCTCAAAC
TGAAATGAATCCGCCTGGGTATTATGGCTGGCGTTATACGATAAAGACGGTGTCACCAGAGGTAAAGAGACCGTCGacacagcttcagcgacagcaaacA
ACACTGTGCTGACTCGAACACTGCCAGAGGATACACCACTCAGGATGGACTTGTACTTTTCGTAAAGTGCGTCGTCATTGCCTACTGTACTAGGAATCGC
AGAGAACTTCGTTGTTGCCACCCAGTTCTTGAACGCAAATTTCGTAGCAGCAATCGTCTCAACAGTGTTGacgagctcctgctcaagctcttcagGTTGC
TTGATCACTGACGCTTCCGTCCTGCAGCCCACATTTGTGAACGTAAAATCGCTCCATTCGACACCTCCCACTTGGGCAGCTTCGTAGAACGTCTTCACGA
CAGCATTTGAGGTCTGAAACACTGACGGCTCCGTCATCGACATTCCCGAGCTGCTACTATTCGCTTTCACAACAGACCCACCTCGATTACGTGGCAGATT
TATTGAGTTCTTTCTGTTTCGACCCGAGACGCCCAGGGGGTCAGCCAGAAGCACCATTCCGTCAATTAGCGGTAAGAGCGGCAGCTTTTCCGGTCCATCA
GTCACTTGTGATGCACAGCCAACTTCTCccagtcgcagcagcgcatCTATCTCCAGTAGAGAAGAAGGATAGTCCACCAACAGGTACACGCGTGCTGGTG
TCTGCGTTGGATCAGTAGATCTCTCTTCGTTGTTCTCTGAGTCCGCAACTTCTTTCTCCTCCGTGTGAGTctcttgtcctcctcctccttcatctgTCTG
TTGTTGTTCATGAGCGAGAAACGCTCTTCTGTCCTGACCCACGAGTAGCTGGAAagccagcgccagcagcggagGTGTCACTGCAActcgctccttctcc
tcctcctcttctgcttctgcagcttcgtctccttcccccgcctcctccgtcctggcagcttcctccagcgtcttctgctcgCGTCGCTTGGTCTCCGCCT
CCTCTGCGTGCGTCACtcgcaccagctcctccagctccgctCGCCCCACGACGCGATACGAGCAGTTCCTCTGCCAGCTCGTGAGCTCTGCATCCTCTCT
CACTATGTTCAGAAGCCCCCTCTTGccagccagcgcctcctccgCCGTGCCACTGGCCAACGCCACCGCAtggaagctccagcgcctcaTGACGACCGAC
AGCCGCGTCGTTTGAAGGTTAATCCAGGTGGAATGTCCCGCTTAAATCCGAATTCTGACCATGCAAACTTCTTGCGTAGCGTTGAATTTGGGACCCTTCG
GACTGGGACAGCTCGAGCCAACTCTTCACACGGTCTCatgcgtctgctgctcgctgtgTGCGCGCTCGCtctggcggcggcggcagctgctccttgcgAC
GAGCGGAAGATGGAGCGAGACgctgtgatgctgctggcggccCACATGGACGGGGAGCTGGGCGGCGTTGGAGCTGGCAAGCGTGACGTCGTTGGTTTCC
AGTATCTGGTATGATAGCCatcgtaaaaaaaaaagtcAAATGCAGCAAACGCTAACACAGTCACTGCTTTTTAATATGTATGTATGACGGCGTAGAaacc
tgcagaagctctCTTGGCGGCGCAAGCTCTTGCTCACGAGGACTTCAATCAGGCAGCAGCGCAGGTCCAGCGCATCCTTGAGTACCAGAAGTCTGACGGG
TTGCTCCCGCACTTAGTCTATGGGCCGTCCGTACCGTCCAATTTACGGTGGATACCCAGCAATCGAACCTTCCACCCAGGCCCAGCATTCTGGCAGCAAA
CGCGATtgacggagcaggaggaggagcaccaggaggaggagattcCGATGTCGCCATTGAACACCTCGACGCTCTCAGCTCCCCCGGTGGCTGCAGACGT
GGCCTGGGAGATCTTCCGATTGGCGCCGTACGAATCGGCACTGGGTGTGAGGACGACTGCTGTTCAGTTCTTGTGTCGCGTCTATGAGCCACTTAaaaag
ctgcaggagcacTTGTTCTCCACACGTCGCGGTCCCGCTCCTAATGGTTTGCTGACTGCTCGTGTACGTTTTAGTGATCGAATGTTCACTTCTATTTAAC
CATCTCTCCACCCGTATAATGCGGTTGAATGGAAACTGATGCGTGTTTGATGATCGTGTTGCAGCACCCTTGGGAGACGTTTTCGTCGCTATCGCCGCAC
TGGAAAGACTTTCTCGCCGACTTGAAGAATACGCCGGACTACGAGACAGTTGTTAATTCTATCCCCGAGGAAGCCCGAATTCGCTTTGCAGTTGGAGCAA
GCACTATATTttcagcagaagacgcagtGGAGAACCTGTATGAGCCAATGATATATCTCGCGGCGCAGACGCACCGCGGAGGAGGCAGTGAGATCTACAG
TCGCGAGCCAACCGTGTTAGAATCCATCGCCTATGCTTCGGGTGGTGGTGAGGCTGCTCGATTCCGGGTCGAGGATGTGGAGTTCAACGCCCTTGTGCTG
CGATCATCCTTGGGCCTTGTGAACATCGGTCACGTGCTCGTGGAGCACTCGTCCGTGTGCACGGGGTTCACTCTAACTCAAAACGATCTTCTGAAGGATA
TGAAGGAGCTCCACGCAATGGCCAGAGGGCTGGAGGGCGCTCTCattggcagcaacagcactcAAGGTCTATGGAACACATCCGCTGATTTTTTCGCTGA
TTCCAGCAGATTGTCATTAACTGCGGTTCACTCCATACGCGGATTCCTACCTGGATACGCTGCGGAACTGGATGATGATAAGAAGATGCGTTCGATGAAG
CACTTCCTCTCGGAACCCGGTTCATTCTCTTTCTTTTGCACTCAGTTCCCAGCTTCATTTTTCGCGTGCCCTGGGGATGACTCGACCGAAGTTGCTGGCT
CGAGGAACCGCCGCTCAGCAACCACAACGTGGATCCTCTACAACTACTTCCTGCAGCGAGGGTTTGCTAGGGTACGTTTGTACCGTTATTTTTCTTTGCA
GTTCACGAGACAAACAGGTTTAACAGCACTGTAATGATCAGAACAAGTTTCCAGGACTGGCTGATTACATCCGCAACAAGACGAGGGACATGATATGCGA
GGCAACTGCACGTACTCGAGTGTCTCGTTCGTGGTTCCCCTTCTCGCTAACGGCGGAGGAGTCCGCGCCAACACCTCTAACGCCTGCCTACAACTCTCGC
AACGGTGCACCGGTCGAAACTTTTGACGATAGTTATTTGGGATCGACGCtagctgccgctgcacttCTAAATGTCCTGCTACCAGCAGGTATGCTAGTCA
TTTCATTCTGCGCAAATTCTGATAGCTAACTCTGCCTTCGTGCTCTTTGTTTCAacagcgacgccaccaccaagtccaGACACGCCGCCCATTGATCATC
GTATTCTCTCTGTAATCATGTGCGTTGAGTTAGTGGTTGCGTTCGCGGTCGCTATGAGCTGTTTCCTGTTTTCGGTGTATTTTGTGGCGAATCGACCGCG
AGAGACACGATTATCTCCTGCATCCGCGGCTCGCCGACGGTCATCTGCTGGGGCTGCAGGAAAGAAATCTCGAGACAAATTGGATCGCCACAGAGAGGAT
TTGGAGGACCGCGGGAGATCAAGTGCTAGTGGGTCATCGTGGGCAGACAGGTACTCGGAGTCGTCTTACAGCGACTATTCTCCGAGGTCCGGACACCCTC
CttacgagctggaggagtcGTTGATTTCAGAGGCGGACGAGCACTACGGATCTTTTGATGAGGCAGAGCAGGCACAAACTCCGTCCAACTCCGCCTGGAA
AGCCGCGAAAAATGCGCTAGCAGCCATCAGCCCGTGGTAA