Description :
From Genome Similarity Track
Location :
Scaffold_35:272254- 277832
Transcript NameFunction/comments
Physo_135006hypothetical protein

Sequence
5578 bases(100 bases per row)
TCGCTTGGTTTTTAAGTTGGGTTACGCGACACGGACGGATGGATACGTCGGCGTTTTGCTGCTGTGACGCTGGTTGCGCAGGAGTTGAGTGAGCGAGCCC
ACCTGTGCGTCGAGCTTGCAATCGTATAATTTTTTCTTCCTTGTATGAGCTCGATACCTCGAGCCTCTTCTTCGGGGCTACAACCATCTTTATCGCTGTC
GATTAACGGTGTGCTGGCAAGTTAGGCACCGTGGGTCGAACACATATGCTCCATTTAAACCATTGCCGAGTCGCTACTTGGTCGTTCAGACTCAGGTGTA
GAGGAAAATTGACTCAAACCTCTCCGATTTGCTGCTTATCACGCGCACCATAAAACATAGTCACGCGGGTGGCTGCAAACTCAAAAACAAGCGACGCCGC
AACTTGGTCCAGTTGCTGGACCGCATGAGGTGTTTCATCGCCTTCATGAACCTTGTGGCCGATGGCACTTAGAAAAGCAAGTTTCGACGGCAATCCCATC
GGCACGGGAGGGAGCACCTGACCGTGAAATTGCTGAAAGAGATTCTTGAATGCCCTCAGCACGCTCGGGTCAGCGATCAGCTTCAGCTTTCTCAGCTTCG
TGTTTTTCTTTAGCGCATCCAATAACCTGCCCATGATCAAGCTGCCGACACCGATGGCTCCCTCTACTGTCATGATCGTTAGTTCCTCCAAGTGCTTAGC
CAGTCGACTGGTTGGATCCCCAAGGAGAATTGCAAATGGTCATGACCAATGTCGTCAACGTTTAGCAGCGCTAGCTTAGTAATAGCCGGTTCCGTTTTCC
CACGAAACTCCTCGTAACAGCGATGAAGCGCTTCAAGTGAATAGCGTAGGGAGAAATCGAGAGCCTTCGTAGCTTCGGACACGTCCTCAGTACGGTTGCC
ATCAATTTCTTACCGCCACCTTGGAAGAGTACTGGAGGCTGAGGCTGTGTAGCGGCCATCCAATCAGACTCAGTAGGTCCCCCAATACTTCGGATTTGGC
AGAAAAACTGATCGACAGCGAGCGGACTGGGCCGGCTCCTAGCTTGTCAGCAGTTAATCCAGACGTCAACACTTCGTCTTGGGGAACCAACGCGCCGCGA
GGAACTCGGCATCGACCGTATCCTGGAAGAGCAACCTCAACCCAGTTGCGTTGCTCGCTCCTGTCGAATGACAGCAGGTTCCTATTGGTGCCAACTGGAA
CCGAGATCGCGTGCTTCGTTACGGCATTGCGATTTTTCAGATGCGCTCCACGCAAAGAAGTACCTTCACGTAGACGCCACTCCTTCCAGACCAACCGTTT
ATTTACTCGGTAACTTTCTTAATGCTTTTCAGATCAGCAGCGTAAAACTCTGGAAACGAGAGATCCAAGCCTTGAATAGATGGGAAGGACACGCGGATGG
ACAAGCGCGGGAAAAACACTGCCCTCGCTAGTACGTTCAAATGAACTCGGGTCGGGCACTTACCCACTAATTCAAGATTTTTCACCGGCGTCCGTGCCGC
TGCAAGCGTGCAGTATAACGCTTCATATTGCCACTCGTATCCGCCAACGAAAGACAGAAATTCGATGGAGGGAATCCTTAGCGGAGGGTCCAAAGACCCC
AACAGCAACCCGGTCACGAATTTAGCGACCCTCGCGGCTCACATCGCGGCCAGCTTCTCGAGGAAATGATGGGAAAATATTGAGCCTCAAAGTTCCGATC
GGGATCCCACTTCCGAGCACGCCCAGCACGCTCTCCACAAAGACCTCACTCATATTCACGCTGACGAGAGTCATCGAAAGCAAATCTAGGCGGTACGTGA
ACGTACTCGCACAGTCACTTAAACTCTGCGCCTCGCCAGCAACAGCAGCAGATTGTTGCGTGCCATAGTCCTTCATCTCGTCAATCACCTCGCGCAGTTC
CTCCATATGAGCAACATATTCATAGTTGTCATCTCACGGGAGCGGTCCATGTACAGAGACACCGAGACCTCCACGGACCGCGGCACGCGTGGGTGTCTCT
TAAACTCATCGTCTTGCATGGATAAAATCCTCCGTTTGGCCTCCAAAAACTCTGGAGTCGGCTCGTAATCCGAAGTGTGCGAGAGGAAAAAAACTTTTCC
ACTTGGCCACGGGCGACACCTCCCCCGGTTTCTGGCTGCCCACAGTCATTTTAAGTAGAAAGCGAGGCGACAGCGGCACCTCTCGGTCGCGCTCGCACTC
GAACTTTGGTGGCTTCGGTGGTAGGGTATAGCTGCGTCGTCCCGGATCCGCGTCCTCCTCGTCGTTGTTGGCGCAGTCACTGCCTTCTTCCTCGGCGAAC
CGCAGCTCGCACTTGTCCCGTAGGGTCTTGGCCCACGCTCGGTTGTTGACGCAGTGCACGAGCGCCAGCAGCTCCAGCGCCTCGCGAGTGAGCGAGTCAG
AGATGTCGTACGGCTTGGGATCTCGCTCGCGCTGCTGGCGGCATGGACAGAGGACCGTGACCTCCACGTAGCCGCCCGATGACGATCAGCCGCCCCTTCA
GCCGCTCGAGCCAGGGCGAGAGGAAGCCCCACGCGTCGGCGGAAGCGGTGGAGGCGGGGGCGGAGAGGCGAAGGCGCTTGTTCTCTTGAGGCTTCGCAAT
GAGGGTCTGGTAGTAGCCTGCAAAATAGTAGCGATAGTAGTATTCAGAGCACCAGTACTACTGTAGTAGTACTTTATTACTGGCGTGCTGCTAGTGATAA
AGCTGTAGTAGTCCGTCGTCCAGTAGTTTGTCGCAGCGTCCTTAACTATTACTTTCTTACTGCAGCCACTCGCACCTCGGTATTTTTCTTAATACCCTCA
GGAGCACAAGAAGCGCACCCGCGTTGTCGTGTTTACCGAAGTAGCAGAACCCATTAACGGAATCGGGGGAATCCCCGACCATCTCATCTACAAGCAACCT
CACACCAATCAACCTCGCCCATCTACAGGGGCAAGCCATGCGTTCATATTTTGTGAAGACGAAGACGTACTCTCTCTGTGTTGCTGTAGTATTGGGTGAC
AATGGGCTGGTCTGCTTGCTGGAATGTTTTGCTAGTAGTAGTGATATACTATTATACTACTATCTACATTTTAGCAACAGTAGACTGACAACCAGAGTTT
GCAAACTTTCAGGGACAGGTCTCAGCTACCTTTAATTGAATAAATCAGTACTTTTTTAAACGTGCACAAAGATTGTCAGAGTTTTTTTGGTCCCACGTTT
GGAGATACGCAGGCTGCCTGTACAGTTGCTCTAACCCTTCTAGCCCCAGACCTTATTCTGTATCCTACAGAATAAGTATTAGACTTGATTAAAGTATACT
TCAAAACCTGTCAAAGATTTGCTGTTGGAAGCCCTTTCGCATCTTGCGGTCAAGCGCTGGGTACATTGTGCACAGAACAGCTACGAAAGTGAACAAAACA
TGCTCAATGTATCCACCATATGCCGAAATGGCGAGCTTCTATTGGTCGTGGCGAGCGTAGAGCACGCTCAAAACCTGCTACATGGTAATACCTTGCAAGG
CTGCTAAGGCAGCATACTTCGGCTCCAGCCACCCATCTTCGGCACGTCGCGATAAACGCGGAGGAAGAAATCGCCCTGTTCCTAACTGACGTAGTGAGGA
GGAACTGGGCGAATTCTTCCTTGTGCTTGACATTAGCGCATCATTAGATTTCTTTAGCCCACCTAACAAGCTTGTTACGATTGTCTCTCTAACAACACCA
GGGAGCTTGCATGCTCAATATCCCGTAATGACACGCACTACACACGGTTCCTCTTGTACGAAACAGGACAATATATGATATTCCTGCCAACGTCTACTTC
TTCCTTTACATGCGCACGCTCTTCAATGTTCGCGCCAGCCGTGGGTCATCTTCGCCATTTTGGCAGCCTCCGCTTTGCTCTGTAGCCTCCGGCACTGCCG
CTTCATTCCTGCCACTTTCATCGGTAGCCTCCGTCGTAGCCTCTGTCCCATCTTCTGTAATCTCCGGTGTAGCCACACCATGAGGAGCGCTTCTTCTGTA
GCCTCTTGAGTAGCCACTGCATCAGCTACAATATAGCGGTAGACCCGGCTGTAGCCGGCTTCGTAGGAACCGATGAGGTTGTGCGCTGACTCCGCAATCG
ATCTGCCAATCGGGCCAAACGCGAGAGCTCATAGCGTCGTCTGGGTCGGATCACCAGGTCTGGTAATCAACATCGCAACGTAGAATCAATATACCACTAG
TACAATGTTACAGAGCAAAGTACACGCTCTCGCTTACCTGTAGATCACAATGGCGCTCATCATGATCGTCTTCGGCCATGGTCCTTGGCCACTTGGACGG
GCCCCAACAAAGCTTGCATTGCGACGTCTTGAACAGCGCAGTTTCGGAATGAAGGAAAGTACGAGTGGCTGACACGCGGCGGTTTTAGGCTTCCACCCGA
ATTTTCAAACCTGTTGGTGGTTTATACTCGTCCGTCTATTACCGCGGAATAAACCCCGTTTATCTTCCCATCGCTAATCTAACAGGAAGATGCGCACAAT
ACCGGCTATACAAACATCCATATGCGAAGTTCGAAAGAGAGGACAAGTTTGCTGGATATTATGTCCTGTGACAATGCTTATTCTGTAGGATACAGAATAC
GGGGTTAGAGGGGCTAATCAGTGCCTACGATGAATCGAATCGCTCAGACACAAGGACTGCAGGGGTTCGTATTACAACGTTTAACACTACACCCAAATCT
CACGACAATTTCGCAGCTGCAGGGAGAACGACGTGTGATCACACCACAGTCGTCGAAATGGCGAACATCTTTCATGTTAACCTCAGTACTTTGCACCAAA
ACGAGCACATCCTTATTTTTTTTGTAAAGGCTTACCTTTACGAAGCACGATTGTCAGATCTCAAGATGAGTACTGTATCTTTAGGAAGTGAAGCGTCTTC
CCAGTGGAATGTTTCCGCACAGCGAATACTAACAGCGCGAGGACCTCACTTTGTGTTCTCGGTCGGACCGAACAACTCGACTCAACGGACAATGCAGTTT
CTTGCACAACTTGTGGTGCTCACCGGTCTCGTATCGGGGGGCCTTGCCAACGGCAGCTGCAGTGGGCCGGCCGCGCGGACAACGCCTCCAAAAGGAGCTA
TCGTCGTTGATGCCACTGGCAAACACCCCGGCAGCTACAAGACCGTTTCTGAAGGCGTGGCCGAAATTCCCAGCACGGCGGCAGAACACACACTCTTTAT
GTTTCTGGGTTCAACCAACCGCCATCAATGCTCTTAGAGTCGAAGAAAGGTACTAAGGTCTACAACGTCAACGTCGAAGCACACCTCGAAAGTGGGGGCC
AGGCACCGGCCGTTTTCGTCAATGGCCTTGACCACGGATTCTACGGAGTTAAGATGACGGGTCACCACTCCACGCTTTGTGCGAACAAGGGCCCTCAAGT
GTATGCCAAGTCGTACATCAACGGAGCTGTTGACTTCATCACTGGCCTCCACGCGAGATCTTGGTTCCAGACCTGCGATCTTGAATCGTTTGGCGACAGT
GGTGCCATCACCGCTGTCGGTCATGGTAACGACCCCAACCCGTCTGTGTTCATCTTCAGCAACGTGTGCTCGGCCACT