Description :
From Genome Similarity Track
Location :
Scaffold_26:27218- 34636
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009549Protein of unknown function
Pytul_DAOMBR144PYU1_G009548Protein of unknown function
Pytul_DAOMBR144PYU1_G009547Protein of unknown function

Sequence
7418 bases(100 bases per row)
ACGTACCTTGTGCGATGGACAATTTGCCACAGTTTGCGGCATCAGCTTGCGAGAATGCGGTCCAGAGAAGCTCGTCTGGGTCGTCCACCTCGAGATCCAG
GTTGCCACCGTTCGCGCTATCACTGCCACTCAGATAATCAAATTCGTCTCCGTCTGAATCATCATCGCCTTCGTCCATATGAGGCTCATCGCCTTCCTGA
ACCGTTTCCATGTGGGATGCTCCACCGCCACTTGCATCGGTGACGCCGCCATCATCAATATGTTCCGCTTGCATCTGCAGCTTTCGCTTCAGTTCACGCG
CTTTCTGCTTCTCGAGTCTCTTGCGTGAGCGAGTCGCCTTGTATGCTGCCAAAACCTTCTTTTGCACCGCAAGCTGTTGTGCGATCATGTCCTCGTCCCG
GGGATCGACCACGCTGTACTGCTCTTTGTTCACCTCACGGGCTTGCTGCCATTGTGTCCAGTTGTGCAGCGACACATGCATTTCCTGCAACTCCGATGCG
CTCAATGGCTGGAACTGCTCGATGCGGCGCACAATCGTGAACTGTGGGCACGGGACTCGCATCGATGGGTAATTAGGGAGATACTTTGCCGCCGAATTCA
CCGGCTTCATGAGTCTGTGCATCTCAGACTGTAGGTTCGGGTCTTGAAACAACGGTCTTATCTCACTTGAACTTGGGCTACTACTGCTGCTTGAGAGCTC
TTCAAAGAACACGCGATACTTGAACGGACTGCTGCTCGAACCATTTGGCGCTTGCGAGCCCGAGTACATTTCCTTCCGGTTACCGCTGGCACTGCGCTTG
GAGTCTTCAAGGAACTGCTCGATATCGCGCGGTCGCAAGATCTCTTTGGCCGTGCCATCGCCATGAAGAATCAGCAAGTGCGGCTCAATCGGGTCGTTTA
CTACCGCTTTTGCAGGAATGGGATCCACTTGGTACTTTTCAGCTTCCAAGTCGCTCACGACACCGGCGAGATCGACTGAGATCTTTGGCGGAGCGCACAG
CGCGATCCCGCGAAACGTCCGCACCGTCGCGCAGTCACTCAGGTCGACGAAAAATTGGTTCTGCTCCTGGTCACAGAGCATGAATCTGCCTTGTTTGCAG
TCAAAATAGTACACGCCGTTGTGCGTCGTGACATCCAGGTCGTCGTCCTCGCCAGAGCCGCCACTATTACTAGTCGTTGTCGATACTCTGTGATACTCAA
CGCGGCCGCTGTCTTTCGCGACGACGCAAACGCCACTGGGCTTCCACGTCGTCACGCGGCCGTTGACCTGGGCGACCACTTTGGTGTTGTAGCCCACTTC
GATGCGCGTGCCGTCGTAGACGTCGACGATGCTTCGTGCACGTAGCCCGCCTTTCGTGACTGCCACGCGCTCTCCGTTTGCATGGCGCTGCGCTGCCGCA
TTGACCGCGATGTCGATCCACACATCGGCAAAGTCCGCTTTCATGACGAGGATATGGGATCTGCGCGCGTTCGTGAACATGCGTGTGCCGTCGGTATGGT
ACACGATCCTCGCGCCGTCAGTGTGGGTCACGATGATCACGCCATTGCGACGTCTCTCGACTAGCGCATTTGTGGCAGGATCCACGACGCGCTCGGGTTT
GCTTCTTGTCGCTTTGTCTTCAGTTTTCTCGTTTGTTGTGCCAATTTCCTTCACGTCACCATTCGCCAGGAGAATGACACGCTTGCCATTGCTGAATGCT
CGCACAACGGTGCCTTTTCCGACAATCACTCGGTACATTTCGCGCTCTTCTCTTCCTTCTTCTTCTTTGTTACGACTGGAAGACGAAATGTACCTTTGAA
TGCTGGTGCCATCGGAGCACGCCGTCACGATGAGACCGCTTGGAAACGTATTTGTGGCGCTAATCGTCGTGAAGCCGTCGGGTTTCTTTGGAAGCGCTCG
TCCTTCGACGATATGCAGCAACGAGTGATCGTGAAACGAGGCACAAAACTGCATTGCATGCCGCTGCTCCTCTTCTTGTGCGAACGGCGTTGACCTGGAT
CGATCGATCTGGCGAAAACCAAACACGTCACTAAAGAATTATGCGAGCAAGATAGATAAACAGCGTTAGTCGTGTGAGAGTCCAGCCCAGACACCACTAG
GAAGCAGCTCATAACAAAACGTACCCACTGTGGTGATAGACGTTGAGCCACGTGTAGCCGCGTGGCGTCTGGTAGACGCGGACCACGCTCTGGTCCGACG
GGAATAGCACCGACGTGTTCTCGGTGAGAAGACTCAATTCGGCCGACGACAGCGGGACGCACGCGCCAGTTGCGCTCAGGGTGCGCGGAGTCAAGTACTC
ATCGGGTACCAATTGCTCTTTCTTCCAGTCCTTGAACGCGACACGATGGCGAACGTGGTGCTTCGCAGTCCAGCGCGTCGTGCGGAACCTCCCAGGCGCC
GTTGCCGCCAATGTCGCGAGTAGAAGCGAGTCCGTCGACGCGTCGTAGTGTTTGTGAATAGCTGGGAAATTGCTCAGAATCTGCGCCAGTCGTTGTGGTA
GAATGGGACGATCGAGGTGCTCGACAAAGCGCCACGAAGACTGCAGTTTGCCCTTCCATGGCGACCCCAGTAGCTCCTCAAATTGCAGCAACTGCTGGGT
CAAATGCACTTGGGCGACGTCTAATGATGAAAACTGCGCGAGTTCGGTATCGCGGACACTACGATCCGCTGGTGCGACCAATGGTGTGACTGGCATGCCC
TTGCGCCCACGGTTACCGACGCCTGGCAGGTCACTGTGCGACCACATGTCCTTCTCCACGGCATCGATCTGTGCGCCAAGGATGCAGCGCGGATTGGGCG
TGTTGCTGCTGTTGTTGTTGTGTCTTTGCTGCTGCATGATGAACGTGGTGTATGCGACGGCGAGACGCAAGGCAGCATTGTCGCTATGCGTGAGAAACTC
TTCCATGTACGACTGATTGTCGTCATTGCTTTGACTCAATACGATGTTGTCGCTCCCTTCCCCAAAGCACGCGATGGCTTCTTTCATCGCAAAGAGCACT
GTGCTCACGCCAACGCTCGCTTCGTACACTGGCGCCAGGATCTGTTCGTACATGGTGAGTGTCTTAGAAGTTTCATCATCGCCTTCATCCTCACTGCCAA
GACACGCCTTCGGAATTGAGATCACCTTGACCGTCGACACCCACGCCTTGAACTCGCGCTTTTGTGCCGCGAGGGTCTCGGTGCTCGTGAGCATGTCGGT
CACCAGCTCTACAAGCACTTTGAACTCTTTCGTAGCTGCTTGTTGGGGCACAGAGAGGTCCATGAACACGAAATCACTCCACTCGAGCCCACCTACACTC
GCTGCGTCGTACCACTCGCGCACAACGTGGTTCACGGTCTGGAACACGCACGGACCGACCGTAGCCGGGTTGAGTTTCTCGAGCTCGTCCATGCTGTCGA
CGCCAACGAGCGAGAATTTCCGTTCTAGCCCCGCGATATTCTTCTGGGACACGCTCTTACGGCGGTCGTTGGGCAGAGAGATGGACTTCCGACGGCTCTG
CAGCTCCTTGATCGGATCCAGGAGCAGCAGCACGCCGTCGATCAGCGGCAACAACGAAAGCTCGTCCTGAACTATGGTTCCCGCTCCCTTCGTGTGCAGC
AGCGCGTGCATTTCAGCGAGCGACGACGGGTACTCGGTCAAAAAGTAAATGCGTGCTGGTGCGCCTTCTCTAGCTGGTAAGGCACTCAGGAAATCCGTAG
AGGAGCTTCTGGTCGAGTCACTGGAGCTGCTCGTGAGCTCGTCGCCTTTTGATGAGATCGAGAACTCGGCCTGTTGTTCGTCTTCCGGTGGCGATGAGCT
CAGTGCTTCGTTCGCCGCGATAAACTCCGTAAATTCTTTCTTATCGTCGAGCACGAGTCGCTGGAACGCTGCAGCGAGCAGCTGCGGCGTCATGACCAAG
TTCTCTTCCAGTGTGGGCAGCACACCCTCAGACGTCGTCAGCATCGCCTTTTGGCTATTGCTGCCTGCTAAGCTTGCATTTTCAGCGGTTGGTGGAGATA
TAGATGCTGCGCCTAGCGTCTGGTCTTGCGCGTCATTTGCTTCAGTCTCCACGTCTTCCTCTTTATCTGCAGCAGCCGCATCTCTATCGCGCTCGAGCTG
CGTCTGCGCGGCCAGCAGCTGCTCCACCTTCATGCGGCGTATGAGCGCTTCCACGTCGTTTCGAGACACCACACGGTACGAGCAGCGTCGCGTCCAGGAG
CTCAGCTGCGCGTCGCTCGCGATGAGCTTGAGCAGCTCGCTCGTTGTCGCGGTCTCGAGCTCCGACGCGCCGCTCGTCACCAGCATCGTCTGGAAACTCC
ACTGCCGCGCACCAGCAGTAGTCGCCTACAGTACATATACGCGCATACATTACACGTACACTTGCATGAGTATATTTTTCTGTAGGAGCGGCGCGCATGA
ACGCAGGAGAAAGTGCCGAAGAGCGGACCTCCGACGTCACTGCCGTCATATTGGCCAAAGTTCAACACAAGTTGCAAAGTGGCTGTTCAAGGCCAGATTG
ATACTAAAGTATCGTTTTGGTACCTGGTACTCGTAGTAACCAAATCTGATTCCACTGCTTCACACTAAAACTGAGAATAGTACTTTGATACCAGAGAGCT
CTTCATCTGATCCCATGTTGGTACCAGACAGTTAACCTTCAACTCATTTAGAAAAAAATAGAGGAGAATGAATATGCGCAGGATCTTCTTCGCGTCGGCG
CTGCTGTTTGTTGCGAATGGCGGTATTTGCGCTGCCACAGCAGTGACGCGCATGCAGCATGCGAACGACACGAACGCGATCCTCATGGCTGAGCTGCAGC
AGCATCCGCAGTTCGTGGCAGCAGTGACGACATCGGCGTGCGACGAGAACGACTTGAAGCACGACGCCATGGGCCTCCTGAACGCGCACTTTGACGTGGA
GCTCGGCGCCGTCGCACCTGGCGATACCAAGCACGTTGGCTTCCAATATCTCGTACGTATGTGTAAGTATCATGCTAAATGGATGGCGTGTGTGTGGGCT
GCTGACAGGGTTCTCGCCTGTATGCATGTAGAAAACAGCGGATGCGTTGTTTGCTGCCCAAGCGATCGCGCACGACGACTTTGATCGCGCAAACGAGCAA
TTCAGGTACTTTACGACGTGTCTATAGTTCATATAGTATACGCACACTAGTTGTGCTAAGTACTCGAGCGTGTGGATGCCACTATGATCTCTCCATGTAG
GAATATCCTCAAGTACCAGCGTGGCGACGGCCAGCTTCCCCATCTCGTGTACGGCGCATCGGTCCCGTCAGCGCAGCAGTGGATTGCCAGCAACCTGACG
TTCTATCCGGGACCAGGGTTCTGGGCGCACAAGAACGTGTCCAACAGCAGTACGTCGCTCGTGACGTCAAGCGTGCTGGCGCCGCCGATCGCGGCCGACG
TCGCGTGGCAGATCTTCAGATTAGTGCCTTACGAGACGGCACTCGGTGTCGTCAGCTACAGGACCGCGGCAGTCAAGTTCCTCTGCGATGTGTACGCGCC
GCTGAAGAAACTACAGACGCTGCTGCTGGAGACACGCGCCGTGAACATGTCGAGCAACCACAGCGACCTGCTGCTCGCAGCTCATGTACGTGACGAGAAC
TTATACAAAGACATAGTCAAGTATCTGCAACTCATGTCAACTGCGTGATGCTTTGTATGCGTATCTGATATCAGCATCCATGGGAAACGTTTTCCTCGCT
GTCGCCGCACTGGAAGCGCTACTTGGAAGAGCTCAAGAGCGCTGACGACTATGTCAAAGTGACGAGTGCAATTCCCGACCAGGCGAAAGCGCGCTTTCGG
CTTGGTGCAGGATCATTGTACAGTGCCAGCGAGTCCGTTGACGATCTGTACGAACCAATGATTTACCTGGCAGAATGCATTCACAAAGCGCTCCATGATC
CATCATCGAGTGCTAACAGTGGAAAGATAAGCCATCCGTGTGGCTTTGCAGTGTACGACCTCGAGTTCAATTCACTGGCGCTGCGTTCGTCGCTTGCGCT
CGTGCAAATTGCGCGCGTGCTCGTAGACCAGTCGTCGGTGTGCTCTGAGTTTACACATACACGAGAAGAGCTACTCGCCGAAGTGAGTGCGCTTCGAGCT
GTCGCGGCCAGATTGGAGTTTGCGATCCTGGGAAGCCAAAAGCAACAAACTCATGGATTATGGAATTCAACGTCCCAGGTACGCGGATCCTTCTCTCTCT
CTCTTGATGCGGTCCATTTCAGGACCTTAGGCTAACTCGGATACTTGCATGGACTCTAGTTCTTTGACGACTCGACGGCGTCGTCGCCAGTATCGCCAGT
CACTTCGGTGCACTCGCTTCGTGGTCTGCTGCCTGGGTATGCGGCGACGCTCCCTTCTGGGATGAACATGGGCATCCTCGAGCATTTCCTTGCACCGTCC
GCGACGATGTTCCATTTCTTTTGCACGAAGTACGCACCGCCGTTTTTCACGTGCACGCCGGAGCTTGGGAACCAACCGATGAGTCTCTTGGTGTACAACT
ACTTTGTCCAGCGAGCGTTTATGACGGTATGTGTTTGGTAGATAAGCTTGCTTTGCTATTCCCTTGCTTTGAATCTAACAGCAGCGTGTAGAATGATTTT
CCAGGGATTGCTGAGTACGTACGGAACAAGACGCGTGAGATGGTATGTGACGCGACCATGGGAGGGCCAAGTACGACGATTGTGCCTTCGCCAGTGCTGC
TTTCGCTCGCGTACGACGCCAGAACGGCTCAGCCAGTCGGTGGATTTGATGATGGATACATTGGCTCGACACTCGCTGCCGCGGCGTTTTTGAATATCCT
ACTGCCGTCAGGTAACGAGTGAATCCCTCTGTGTGACTTCCGAAAAGCTACATAGGTATTTTATTTACTCTCACTTGCTTCTGTGAACTTGTTTCGTAGT
CGCGGCACCACCGAGCCCAGACGCGCCACCCGTGGACCACCGCATGCTCACAGTCATCATGTGCATCGAACTGGTCGTCGCGTTCGTCGTCGCGCTCGGA
TGTTTCCTGTTTTCCGTGTACTTTGTCATCAAGCGACCCCGAGATACGCAATACAATACTAGCAGCAGTGACACTACGAGAGCACGAGCCTTGTCGGGTC
GTAGACAACCGAAAGCAGCAGCATCCGGAGCTGAGAAGAAAGCGAAACTTCATGACGAGGACGATGATGATCGTGTCCCCGGCAGACGCCAGCGACGATC
GAATGCGCAGCAACAGGGCGATAGGATCGTGTATGCGGAACTGTCGGATGCCGAAAATTCGCAAGATTTGGAGGAGTCGCTGCTCTCGGACGACGAAGAC
CTGGCGTACGGATCCTTCGACTCGGCCGATCCGCACGGTGACCAGCACGAACGAAATCACACGTCAACATCGTGGGGCGCTTTAAAAGACGCGCTCGCCG
CCATCAGTCCGTGGTAAA