Description :
From Genome Similarity Track
Location :
Scaffold_257:27218- 28230
Sequence
1012 bases(100 bases per row)
TTTGTAACAGAGCACAGCCAATGGCAAAATCCGAAGCGTCATAGACGACACTGAAAGGTCGATCAAAATTTGGCAAAGCCAAAATCGAGGCATGTAGGAG
ACTTTCCTTTACGGCCATAAAAGCCTCTTCTTTGGCGCTAGTCCATCATCACTCCACTTACCTTTTAAGGAGATTGTATAATGGCCGAGCCATATCAGCG
TAATTCTCGCTATACTTGTGCAAAAAATTGGCAAGGCCAAGCCACTTGCGTAGATCTTGCTGGTTCTTTGGGACTGGCCAATCCACTATAGCCTCCACCT
TTGCAGGATCTGCCCGAAGGCCTCGCTCCCCAATGAAGCATCCCAAAAATTGAATCTCATCAGCACCAGAGATACATTTTGAAGCATTAGCATAGAGCTT
ATTAGTGCGGATGCACTCGAGCACAGCGCGCAATGGTCGATGTGGTTATCCACGTCCGACCGACCCTGTTCCGCCCGACTATGGACAAATATATCATCAA
AATATGTGTGTGCATACGCATGGTGAGGGTGGAACAATTGCGTCTCCAGACGATTAAACGTAGCCGGGGAATTGGAAAGCCCCGGGGGCATAACCAGCTA
CTCCCAAAGCATACCGCTTGGAGTACTAACCGCTGCAAGCGGAATATCACTTGATCGCACGAGCAGTTGATAATAACCATCGACAAGTTCGAGTGCACTG
TCCATTTTACATCCTTCCATGTTGTGCTGAAAAATTTCTTTTCTAGGAATGGGTTTTTGTGCCGGTAGAGTGGCCGCATTTAGCTAATTATAAGCACGTA
CAATACACCACTTACCATTAGGCTTTTTGACACAAAATGTCGGTGTGGAATGAGTAGATTTGCACTCACGCAACATTCCCGCCACGCGCTTAGGACTGAA
AAACTCGTCAATGACGTCACATTGTTCCTTTGGTCAAGGCCACTGCCGTGTAACGCAGTAACCGGTTCCTGGGGTCAAGTCAATTTCATGACGTACGCCC
TTATCGGGAGGT