Description :
From Genome Similarity Track
Location :
scaffold_257:27216- 28402
Transcript NameFunction/comments
Pl_106947hypothetical protein PHYSODRAFT_445559

Sequence
1186 bases(100 bases per row)
TTCTCATCATCTTTACCACCTGTGAGAACCACAGTATGATAAAACCCTGCTGCTATCAGTGCTACTCGCTTGCCCACAAAATCATCTATAGGAAATGGGT
ATATACGTTCGTTCGTATCACCAGTTCCCAGTTGTCCATGATTGTTTCGACCAAAGACGTATATCACCCCATTATCCGATGCAGCGACAGTGTGGTAGCA
TCCGCATGCAAAACGAACGATGTCGTTGCCTTCCAACTCCTCAATCAACCTTGCGTACGAAAACCGTTGCTGCTGAAGCTGAATATTAGCAGCTGAACTC
GCATTAGCACGACCCAGACCAAGTTGGCCGTAGTCGTTACGACCAAACGCAAACAAGTGTGCTCCACTGCAAAGAACGATTGTGTGATAATATCCACAAC
GAATTTCCAAGCACTCCTGCTTCTCCAATCCGCCTCTTACTTGTACAGGAACCAATTGATTGTCCACAGAATCAATGCCTAACTGTCCGTAGTCATTTTT
GCCAAACGCGAACGCCCTGCCAGTAGCTGTCGCGACCATCGTGTGATACTGTCCGCATGCAACAGATACTATCTGCTGATCATTTAATGCTTCTACATGT
TGAGGAACCTTACGATCGATTGAATCATTATGACCAAGCTGCCCATAGTCATTTCGCCCAAACGTGTACAGGAACTGTTTCCCACCCCCACCTTCTTCAC
AGGCCATGACCGTGTGGTAATAACTGCAAGAAACTAGCCGTACGATTTTGCTTTCCAGACTTCGAACAATTTTTGGCACGCTCTCACTAGCAGTATTTCC
ATGACCGAGTTGGCCACGATAGTTGTAGCCACAAGTTGCTGCCCGACCATCCGTCGTAACTAGAATTGTGTGTTCACATCCGTTGTACGCATGAACTTGC
GAAATATTGTTCTCCCCCATCTTTGGAATTTCGCTTAAGTGACTTACTCGAGCTGTTCCCCCTTGACCGCACTGCCCGTTGTCATTATATCCACAAGTAA
GAGCTTTTCCATCGGCTGTCAACGCAATGGTGTGTTCATTTCCAGCGCCAATCTGAACAATATCTTTCTGTTGGAGCGACTGAATCTTTTCAAAGGATTT
GCGTGATGCCGTATCTCCATGTCCGAGCTCTCCGTAAGAATTCTGTCCACAACTCCATACTTCCTGATTTCCATCGTCATCGTCCC