Description :
From Genome Similarity Track
Location :
Scaffold_27:272155- 273847
Transcript NameFunction/comments
Physo_133660predicted protein
Physo_133661ubiquitin conjugating enzyme

Sequence
1692 bases(100 bases per row)
GAAGTCCCCAGCCGACGACGACGAAGTGTGGTAACCGTTCGTAAGCAGCACAAAGAACCACCTCATCCTCAACCGAGAACGCCTCAAAGTACGCAGTGAG
CAGCACCTTCCAGGCCTTGCGCTCTTCCCACTTGAAAATGGACAAGTACACGGTGGTCTTGTCCGTCATCTCGAACGCCGTCTCGCTCGCCAGATCGTAC
ACTTGCTCCACCTTGTCCGGGTCGAAGAAGTCCACGTCAACGACTTCCGGTACGACCTTCACGGCTTCAGGCCTGACCCCGCCGTCAACAAACACCTTCT
CCTGGAACTTGGTAGGCACCCAGATCTCGTCCATCTTGTTCATCCTCTCGGGCCAGCCCTTGGGCACTCGGTCCGTCTCGAACATGGTTCGTCCGACCTT
GTACTGGGCCTTCTCCGGCGGACACCTGGACGTCATGTAGTGCGCGGGCTCCCAGGCGCCGGGCTCCGAGTGACAAATTGCCAGCGCGATCTTCCTGTTC
TTGAGCCGCCAGTAGAAGTCCCGCTCCTCGATCCAGTGGTGCTCCAGCTTGGAGCGCATGTCCTCGGGCAGGTCTCGGATGAAAGACGGGTTCAGCGAGT
CTCCGTGCTGCGTAATCAGCAGCTCAAAAGGGGGTTCCATTGCCTCCTCGCTCTCATCGTCTTGGCTGGCCTCTGAGTCCTCTTGACTGCCTGAATCCGA
CGAAGATACAGTTGACTCCCCCAGTGCAGCGTCCACGGCCACGACGTACGAGTGCGCTTCGCTGCAGTAGCCGCCGCCGCTGAGGAAAGGGGCGTACCAG
AGCACGGCTGGACGTCCAGACTCACTGGAGACGGAGGCATGACGCCCTGAAGCCACAGCAGGCGTCGCTAGCAGCGCACAGAGCGCGGGGAAGAGCAGCG
CCACCTTCATCTCGAGGGTAATGATACAATTCTGACAATAAGAATCGAAATTTCGCAATAGAATTTCAAGTTGAACATGATAACTTTCGCGTTAAGGATG
ATGGTATAGTTGCTGCTACCGTTACCGTTAGTTGATCTCCTGCGCTCGCGCTGTGTTTAGCTGCGTATTGCGTAGGGAATGACTGCGTTTTGTTGTTTTT
GCTGTTGGTCTATCGAGTTGTTACGTTAGGACGCGTACTGCTTGGTCCACTCCTGGGCCGTCTTCTCGAAGTCCGCCTTGTTCTCGTGCATCTGCTTGGC
GATCTCGGGCTCCAGCGGGTTGTCCATGTCGGGCTGCTCCAGGATCTGCTTGATGGCCGTCAGGCAGTGCAGCACGTTGAGCGTCGGACCCCAGTTCTGT
CACACAACATGAAAGTTAGGATACATCTCGGGGAGATCCAAGGGCTCCAAGCTCCATCTGCTACCCACCTCGTTGATAATATCAGCGCAGATCTCGCCAG
ACTGCGACTTGACGTTGGGGTGGTACACGCGCGTGAGGAAGCGCACCTTGGGCGCCTTGAACGGATACTCGCTGGGGAACTGCAGGTCCAAGTTGAAGAC
GCCTCCGGAGTACGGCGAGTCCTCCTACAGCACCAATTACACAGTTAGCTCCTTGTTTGCTGCACCATAGTAACGTTGCTGTCTGCAACTTACGGGGCCT
GCGAGCATGGCGTTCCAGTGCATGAGGTCGTCGTCCACGGCGCTGACAGTGCACCACTCGGGCGAGTTCTTCTCAAACTCAGCGAGCTCCTA