Description :
From Genome Similarity Track
Location :
contig_4:272138- 273543
Transcript NameFunction/comments
g1108.t1hypothetical protein PHYSODRAFT_317888

Sequence
1405 bases(100 bases per row)
GAAGAGTGTTTGTGACACGTTGATCCTGATTGCTCCTGTCTGCAACACGAACTTCCGTGGACGCCACCCTGTTCTGCTGGACTAAGTGTCTGCATCTCGT
GCTATCGTAACGTTTGCAGCACTTGGTGTGATATTTGCAGCACTTGGTGTGATATTTGCAGCACTTGGTGCGATATTGCAGCAGGAGCTGCAGCTTCTTC
GTCTTCGAGCATGAGATCTTGCCAGTCGTTCTCCAGCAGCCACGCAGAGGCCACCGCCACGCTCTGGTCGCAGATCTCCAGCTGCGAGCGAAATGAAACG
AAGTGAGCACAAGCCACCACCGCTCTGGATATGCAGCATGCAACTAAGATCTTACCACGCGCAGAAGCGCCTCGGTCGGCACCGTGGGGAATACTCCGCG
GAGCGTCGTCTCCATGGCTCAGGAATCTCTCTTGGGATTTCAAGATTGGGCGGTAATAGTACGCTAGTACTATAGTAATAGTATAGTACTTGCTAATACT
AGAAAGTCGCATTGAGCCCAGCATTTATACGCGAGCAAGAGGGCGTGGCAAGTTGCCATTGGCAACGGCGTCCAGCCAAGCGGAGTACATGCGAGACACG
TTAGCAAGGAGAATAATGACGCAGGCATTGAGCCTCATGCGTGCTTAGATAAAAAACACTACTGTGTATTGTTCAAGTACTAATATATGTACGAACATCG
GGACTGTCGATGGCAAAGTCGTTTTCGAGATGAACGGGGACAAAATCGAAGCGCCTAGATTGCATTTAATCACGCTCACGATGTTGAGCGGGCCCGATAT
GTTTAGCGTGGTTCTCAACAGTAGCAGCAATGTCCTTGGCCACGTCATTTCAAGCTCCGTAGCATCCTCCACGAAGTTGGTGATCCCAACGCTGTCCGAA
GACACGCAACAATCTGGTTCAGAACATTGTCCAGCAAGTTGCTGGCAGCAACTCCTTGCAACATTCATGGTAGTACATAACCACCGGTAGCGAACACGCT
CCGCAAACTCGCAGGCGGCATCATCGTTCGTTAGCTCTTTCCACGCCGGCTAAGGTAAGCATCAGCGACGGGAACTTGAAACCAAGGCGGGCATTTTGCG
TAATAAATTACCAATTAAATTGCAGTTGCATGCTACGTGGAAAATGCAACTGGTATTCATACTCCTTTTTTTGTTGAGAATTCGATAACTTAGGTGGATT
TCGTGGGAGGGCTTCAGCTCAGTTTTAAGTGGCCTTTTATTTGAGTTTTTGTACTGTCCTACAGAAGCAGTAACCACACAAGTACTGGAGCCTACCGAGA
AGCTTTTCTGGGAGGGTACACATCAAATTGTGTTGAAAAGCACCACGTCGCGATCCGAGTAAAACACCAAATGAGTTTTCACGTGTCAGCAGTTTCCTAT
CTTTG