Description :
From Genome Similarity Track
Location :
Scaffold_1:2721303- 2727903
Transcript NameFunction/comments
Phyin_T30-4PITG_00514Myb-like DNA-binding protein%2C putative
Phyin_T30-4PITG_00515Putative uncharacterized protein
Phyin_T30-4PITG_00516Putative uncharacterized protein
Phyin_T30-4PITG_00517Putative uncharacterized protein
Phyin_T30-4PITG_00518Nucleoredoxin%2C putative

Sequence
6600 bases(100 bases per row)
TGAAAGCGTATAACTGATATTATCTCGTTGTAATTTGGCTCTTTCTGCCGAGCAGGACTCTCTTGAGATGTTACGGATTGTCGCGATGGCGCAATAAATT
AGGCAAGAAGCAGGTCGATAGATTCCTGCACGTCTTGTCGGTAGGCGTCGTCGGCCAGCACCTGGTCGAACGACACTTCGGACGTGTACGGCAGCGGTTC
CAACTCGAACAGCAATGGCTCCATGTCGACGTCCATGTCCAGACTATCGAAGCTGATGGAGCTTATACTGCTGATGCTGTCGACATCACTTGCAACAGGG
CTGCAATCGCCAGTCAGCAGCTCTCCAAATCCGCAGCTTAACGGTGACATGTCCCCGACTGGAAAGGCCGACGGCGAGCGTGGCGAGCCCTGCACTGTAA
AATTCTTCACGCGCTGAATGCAGCCCGTTGCATGAGCGTCCACGCGGTGCTCGGGGCGCACGAATTTCTTCTTCTGTTTGCGCAGACCGCGTCGTCGGCG
GTTAATCTTCTGCTGGTATTTCTGTGCATGCGTCTGCACCTGCTTGATAGATCGCGTACCAATAAAGGCGGCGATGGAGCGCCATGGTCCCGTCGGGAAC
ATCTTCATGGCATGCAGGAACTGTTCGTGCTCCTGCTCGGACCAGAGGCCACGCGTGATTGGCGTCGTTGGCGCAGGCGCGACAACAAGGCTACCTCCGT
GGGGGCTAGTGGGCATCATGATCATGGCGTCTGTCGCTATGGTTGCTGTTGTGCTGCGGCTGGGTGCGCGGCTCAAGTAAAAATCGGAAATGGGGTCAAA
CTCGCGACGTGATTGATGTGGCCGCTAGTCACTTTTTTAGCTTACCTTCGCCATGACACGCCGTGGCCCTTCTTCGCGAAAATGGGGGGATGGGCATATC
TGAGAGCGAGTAGGGGTATTTTATGGCTCAGCTTCGTCCGTGGTGGAATGAATGACCAATGGCAGCTGGGTATCCCGCGCGCCTCGTCTGCTCAGTTCCG
GTACAGTAGGGCGCGGTATCTCAGCGCGCTAAAATTATCAGTCGGTAAAATACGAGCTTACTGTATTAAATAGTGAAGACGCAGCGGATCAGCATTATTA
TAACATGCTCTCGTGCCGAAGCGGCTGCTTCTCAACATTTTCACGCGAGACGCATTGAACAGTGAGAACAGTTTTTGAAGCGAACCTGTGGCATGCAGTA
GTCGTGGCACCAGGCGAATTACATAAAGGCAAGTTGCGGCTTGCAGTAGGCTATCCAGTTTTGAGAATTATAAACGTTTAATAGTATGAACAGTGTTTGC
TGCGTCTTCGGTACGTTTTAATAGTTAGGCTTCATTTTGCTGAGATCTGCCGCTGCTGCCGGTTGCAGAACTAAAACGCGCAGACAAAACGGCCTACGTC
AACGCAAAATGCATTTTGGTGCTGTCTCTGCTGAAAACGCTAACCGATGTTAGACAAGTTGCAGCATCTCATGCCGAGTAAATATAATAGCGTAAAGGCT
TCGGCTCTCATACTTTCGCGTTGATATTCCTTGTACACGTATGTTTGCTCTACAAGTGGAAATTAGTTTGCGAGGGTTACTGGGATTTCGCTTTGGCCGC
TGTCTTCGTCACTGGTATAGATGTCAGAAAGCTTGGCTATAAGTGATTGCTTCCGGTTGGAACGGCCTAGCTAATCGCACAGACAGTAGCATATCCAGCG
GTCCGATGTCTTATCGCAGATGCCGTCTGAGCCATGCGCTGCCTATACAGTTCTTGTGCTGCAGCAGCGATACCGGTAGCTTTGGAAATGCAAGTATCCA
CTGGTTGCTGGCCTGTGATCAACCCTGACTAAACCCCTTGCAAAAATCTTGGCTGGTGCTATATAATAAATGAAGCATGTGCTTTTTTGCAACGGTATCA
AGGGAGGTGTTGATTTTATGATCAAATCTGGGCACATTTTGGTCACGAATAGATAACTTCGGAAGCCTCCTTACGGGCATATATGCGATACATATATGCC
AAAGAATAGTCACGCGTGTTGGCGGTGCTGCAAAGACTGAAGGTCTCAGGCGTTGAAGTAGCCTTGACCAACGGCATTGGCGCGATTCCAGTGCCGTCCC
AGTCCAGTACCAGTACTCGGACTCGGCATGCGAACATGACTCCGCCGGCACGCGCGACGTTCCTTCGGTCGGCTTCGCTTCTCAGTCTTTTCTTTTTCTT
CTTTTCGTTTTGCAGCGGGCTCGCATGGCTTTAGTCAAACAGAGTTGCATACACTGCATCTAATTCACTCAACCAACTCATCGAGTCAACGAGTTGTGTG
TTTATGAGACACCAGCGTAGGGCGCTGCATGCGAGCCGCGACGTGATGAGGCCGGTGCTGGATCAACACACTTTGGGAAGCGCGGCCGCGTCCGAGCTGC
GACGCATGCCGGCTCTTCCAGGGAAAGCTCGCTCGGCGAAAATGCGAGCTTTGTCAACCTGAAAGTTTCACTTAGCTATTCATTATTGATTGGATTCCTG
TCCCCCCATTTGAGTGGGTTTCACACGAGGTGCAGTGCAACTCTCGCTGCGAGTCTATATTAATAACAGCGACACCTTTGCACAGACAGATATCGAGACT
TACAAGTGCTAAGCGTTGAAAACGATGACCAGCGAGCTTTGAGGCTACTTTAACGTGTTGCAGCTCGGTTTCAGTCGCGAGTCAAGCGGGGGGCTCGTTA
TTACCAGGCTCCATCGTCGAAACTTGTCTCCAAAAACGAGCTTCGATAAAGTCGACGATCGTGTTCGGTTGGTACATAAAACAGTGGTCATGGTAATAAT
CTAGTCTACAGCATTCGCAGCCCCAGCCCATCTCCTAACGGGAGGACCAAATCTTTTTTTGTAGGCCTAAGCTCAAATTTTGCGAAGGTTTCCGCTGGCA
GGCTGCAGCTATCGGCGACAAGCGGCGGCGTTAACTCAGCGGCTCCGGCGCTGCTATTAGCGACACAGATGCAATGCTGGGTGTTGGTCGGCCTCATGTC
GGACGCCGCTGAGCGGATCATGGCTGTGTGCGACAAGCTTCTGCCAACGTGGCGTCGCCGACCGCGCTGCACGAGTATTGTAAGTTGTGGCGAGTTCTGC
TGACTGCATTCAGTCCATTGCAGACCCACTGTCACTGTGATGCATTGGCAAAGGAAAAACATGTACTTGGGACAAAGGAAGTCTGCGGCAACGAACAGCT
AAGAACTATGGAGCTTGGATACAGAGCCAATCGTGGTGCTGGACTGCGCTCAGATATGTGTGCACGCAAGTTTCGGAAGTTGGCGTGCACGTCTTATGCG
TGAAGAGGCAGAAGATCGCTTGCTGACATAAGGTTACTGAGGCCGTCGCGAAGGTTCAACGCTGATCGATCTCGAGGTTGCCTGCTTTCAGCTCGGATCA
CGACGGAACCGACCATGGGACTGTCCATCTGGGTCGTCTGCCGCAGAAGGCAAGGTAAAGTTGACACAACTGGACCAGACCACGGTAACGCCGGCCGACT
TCCTGTGTCTCAAGTCTCGCGAGCCGATGTTGTAAGACTTATCGCTAGTATAGAATGGCATTAAATCATTAGTAAGTCGGCCGGGACACACTCGTTCATC
AAGCTGCAGCCGACTTCCGCTGCTTTTTAAGCTGTGGCTTGTTCACATCGCCATTCACTTCATTTTCAACCTGCGCCTCCTCCGTCTCATTACCCGCCCC
TGCCACACTCTTTCTCTTACGGGCCTTTGCCGCTGCTGCGCGCTTATCAATCTCAAACTCAAAGCCCACAGGCGTCGTAAGCTTCGGAAGTCGTACGGCT
GGGACGCCGACGCCCCCACTGGCCGAAAGTGCTTTGGAGAACTGGGCGCTCTTGCCTGGCGCCGCTCCGTGGGTTGTGGCGTCGTGGTACTTTTGCGTTT
TGCGCTTCTGGGCCTGCACGCGCTTGCGGATGGCAGCGATTTCCAGCAGCTCTCGGGACGTCCGTGTTAACATATCGGCACGAGAGCGAGCGGTATACTT
TTTGATCTTGCGGAATTTTGGCGACTGCGGGATCGTCAGATGACCGTTTTCCTTGGCCACACGCGCTAAGCGACGTCGCTTCTGTGCCACCTTGCGAGCT
TCAGCCACTTCCTTGTCTTTGCCAGTCAGCACCTTATCTCTTAATGCGGCCAGCGAAGCTTTCGTAGGCTTCAGCAGGCGGTCTGTAGATGATATTGCGC
GTACCCTGGGCACGGGTGCGGGGGCGCCGCGGAAAATGGCGTCCAGATCTACGGGGCGCTTCGTCGGCGCCATTATTGTCCGAAGTGCTGCTTTTCTCGA
ACTGGCGGGAGGCATCCCATACAAATAATAAGTCTTTTTTTTAAATGAAAAAATTGTTTTTACCAATCTAACAATTATTAATACATCATCCACCAATGAA
ATACACACGGTGGTGCAGTACACCTATTTCTACTCTATTGAAGATGTCAACTTCGAGAATGCGCCCGGTGCCTCCAACTCGATCTCGACGCACTTCTCCT
CTACAGACAAATACCATCGATGTACCAGCTGCAGTACAGGCGCAGCATGTTTCAATCCCGCTAAAAGCGCAGCAACCGCCTACTTCGATGCCTCCCAGAT
TGACGCAAGCAATCAAAGACGAGTTTGCTATCCGCTACCTGCAGCAGATTGGCGCCAATTCCACCCCAGAGAACATTGCAATGGTGTTGCAACACTTACC
ACTGGAGAAATGTGCTGTCTCATCTGCCTGGAAATCTCGTGGATCATTGGCCGACGTTTTGCAAATCGACTGGAATCCAAAGTCGCTTAGTCTGGGTGGT
GAGCCTCCAGTCAAACTAGCTGCTAGTGGGGTGGGTGTTCATGTAACTCCAATAGCAGCGCTATTGTCACCGAGACGACAGCTACGTGGTCAGCATTCTT
TTCAAATTGGCACGGTTTGCTTCACCTTTGACGATATGAAGCGTAAGTTTTTGCTGCCATTCAAACTAGCCACGGTGCCCACTGAACTTGATGTCTTACA
AGTCTTTGGAAATCGCTTGGAAGCTGACAAAACACTGTCGCCCAACCAAGTGGAGAAATATGGTGGTGCGCCTGGCTCACCCACAGCTTTAGGCTCTATC
GCTGAGTGGGAGGCACATCGACGACTCAAAGCTGTAGACGAGCGCAATGTCCCGCCGAATGCCAGCGCAGAAACAGTGTCAGAAATGCACAACGAATTTT
ACCTCACGTTGCCATTGATCTCCTTAGGGCTGCCTGAGGGTAACGAAATTACACGAACGGTACTTTACGAAGCCCTGTCAAGCACCGTCATGATAGAACT
TGTTCAGAGCACCTTGCGGTATCTTTACTTTAAAGTGATCGACCCAACAAGGAAGAAGATACGCATCAGCAACGAGCAAGACGCACTTTTTGTCGCCATC
GCACAGCAGTTTGCTCTGCTGCGAGTCAAGATGGAGCACAAACAGCGATTGATTCCTCGATCGCTCACAGTGCTCGTGCCATTATTGCTACTCGCCCTTC
GCGTAGACATCGAGACACTTGTTCGTCTACAATACCCACTAAGCTTCTCTTGTGCCTCGGAAGAGATGACTCGACTCCTGCAAGACATTGACGCTCAAAT
AACGCGGTTATTAGACCCTGATGGTAACTGGAGTCGTTTGGCCGTGTTGGAGACAACGCACGAGGCCGGTCAAGCTCGTGCATCGTCCACGTTTCAACGT
GCTCGTAGATATCGACGCCTCCGCGACCAATTCTTCCAGACTAGCGCAGTGCTGCATGGTCTCTTCCCTGACCCTTCGTCGGGCAACTCTCGCCGCGTCA
TGACTCAACGTGGTGGTGCAGGAATCAGCCATTACACACACTTTTTCAGCAGAGCTGCACCCACAGCTAAACAAGAGGAATGTCGTTTATCGGACGTATC
CGTTGCTTCTAAGCTATCTCTACTCCAAAGTCTTCGACGCTCACAACAATCGTAAATCATAGCAAAGGGAAAGATCGTATTTTTCTCAAAGGCTCAGAAA
ATGAAGAAGTTAATGCTATCAGCGTCAATAAGCCAGATTTCTGACCCAGGCTGACGGCCATGTTTACTTGTTCAGTTCCTCCCAGAGCTTCTCCACGTCA
CCGCGCGAGTTGGCGACGACGGTGCGGCCGTCCAGGGAGATGGTCTCGCCTTCTGCGTTCACGAAGACCAGCATGGGGATACCCGTGACGCCATACTTGG
TGCTTATGGCCTGGTTGGCCGCGCGTTCGTCGAAGGGCAAAGCCAGGAAGGGCATCTCGTTGTAATACTCGGCATACTGCGACGGATCGCGGTCGGACGA
GATGAAGATGAGCTCGAACTCCGGGTGCTGCTCGATCATGTCGTCATACACAGCGCTCAGGAAGGGCGTGAACTGGCGGCACGGGGGGCACCAGTGCGCA
CTGAAGTAGAAACCCACCACCTTCTTGCCGGCCAGCTTGTTGTCCGTGTCCTGGAGACCGTCCTTTGTCTGGAGCTTAGCGCCGAGCTGTTCCGACCACT
TCATTTTGTATTTAATACTCTTTCTTGGGGGTCGACAGCGAGAATTATAGTGAGTGAAAAGTTGTGTGGGTATCCAAATGGTACTGTGACGGACAGAATA