Description :
From Genome Similarity Track
Location :
Scaffold_210:2721- 7413
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_210-fgenesh-gene-0.5SLD5
Pytul_var.sporangiiferummaker-pug3_contig_210-snap-gene-0.29Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_210-snap-gene-0.20Conserved gene of unknown function

Sequence
4692 bases(100 bases per row)
CGGCAGTTGCGCTTCATGGTGCGAGAGCTTTTTCTTGCGTGGCGGCGCATCGTACTCCTGAACTGCAATGGAAATACAGGCATTCACACGCACACACACA
CAGGCCAGGAAATAGCCAGCACATTTTACACGGGTACGCATTATTGTGCTGCGAGTGTGAGCGTGGACTGGGAAAGTTCTACATGACACGTACCGCAATG
AACAGACTGGAGACAGCAATTGTACGCGCCCATGACGCAGACCCGCTCTGTATGGGAGCAGGCCAGTACAAGTAGTTTAGTGACGAGTCTGCGAGCTGCG
TGGGTCTTAATGCAAGCGCTATGAATAAGGGGCAATAGCCAGAGGCACCAGTGAATCATCGGCATTGGGAGCCCATTTGCATGTGTGTAGCCTTTCGCGT
CCACTTCTCTGGACTGTTTATTTTTTTTGAAATAATACCGGTACATCAACCGGTATTCCAACCGGTTTTTGGCGGGTAGTAACTTGGCGGCAATGTAATG
TGTGAGCAGCCACAACGGAAAAGAAAATAAGATTAGGAGCCACGCACGATGAGCTCCATGGGCGAGGACTCGCAGGCAGAGTTTGACCAGGAAAACCTCA
ATGAGGACGTCACGCGCATGCGCGCGCTCTGGATCAATGAGATGGTGCGCTCGTGCTGCTGCGGTGCCTGCCTGTGGTCCGCGTATCGAGCTGCGTTTGA
CGGAATTATGTTGGTGCACAATTGCGCTTGTGTTGTAGAATGCGCCTGAGATCCTGCCGTACGATGAGGAGATCGTGTCGGAGATGCTTGACCAAATCCG
GAACCAGGTATGCTATGCACAAGATACACGTGCGCAGAGCCATGCTGGCTGATTAGCTGACTGATTGGTCGCGCCCGTGGACAGCAAGAGTATGTGGATT
CGGTGAACGAAGACAAGGACAGTTTGACCGAAGAGCGCGCATTCGTCAACAAGTTGTACCAGGTATGTCAATGTATCGTCCAGTGTTAAAGTCCACAATC
AGCGTTAGAAAACTGACACGCTGAACCTGGTACTCGAGCGCAGATGGAGATCGACCGCTTACGGTACATGGTGTCATCGTATTTGCGCACGCGGCTGCGC
AAGATCGAGAAGTTTGCGCTTCACCTGCTCAGCGACGCCGTGCTATCGCAGCGGCTCTCGCAGAAGGAGCTCAACTTTGCGAAGCAGTACGTTGTGCTCT
TCGAGACCCACGTGAACGATCTCGCACTGGGCAAATTCGCCGAAGAGCATCGCAGCATTACGAGCGAGGGCATGAGTATGTCTGCGCCATCTCATTGTTT
GTGCCTATGGATGTACCGCCTCTTTTGTAATAATCTCGTACATGTGTGCTGGTATTGATTGCAGTCGTGGAGCCTGATCTCGACACGTTTGTGTTTTGCG
AAAGCAAGACGGCGCTGGGCCAATTGCAGTGCGACGACCGCGGCGCCGAGTACATTACGATGCGCAAGTCCGACCGGCACGTGCTGCGCTATCGCGCCGT
GAAAACGCAGGTGAAAGACGGCAGCGTTGCCCTAATTTAGATGCACACTAGCGGAGAGAAAGAGATGGGTACATCCTCGTGATTCAACGCACAAACACGT
CGCTCGCATCCATTCATTCCTTCATAGATGATAAATAGCATAATAAAATGGACGAGGGGCTGTAAAAGCCCACAAGTTACGCTCGACAGCGAATGGTGGT
TACACGGGGGGTCGTGAAGAAATGGCGTCGCTGCAGCACACTTCTGTCTAGTAATTAGCTTTCGACGATGTCTGCATAAGCGTTCGATTGCGTTGATAAT
GAGTACGGGTTACATGACTGGTACTCGGCTCCGTCGATGGACGTCGTGAGTGCGCGAGGCTTGGGGGGGATAAAAATAGGGGGACTCGGTGATCACCAGA
GCGGATTCGCGAGCGATGCGGTCGCTGCAAAGACGACACAGAATGCCGCCGGCTACAAGAGCAAAAAATAAATGCAATCGCAGAGAATGAGCAACAATCC
ACCCATAGCAGATAGAATGCTCCAGTTTGACATGGCGTACGATGAGGAATGCAACTTCGACAGCCATGATGGCAACTTGGAAATACTCGTAGTGGCTAAA
CACGAGATTCGGCAGGCAATATCGTTCGTATAAATGCGGCGCGAGCATGACGTTCCGCGCAAATTCCATTGCACACACTAGCAAATACTGTCATGTCACA
AGAGACAACACACATTGCATTGCGATTAGTGCCTATCGTCATGGCCCCACGAGATTTCTTTTTCTTACCACGATAGTCCAGCTCATCTTGTCTGAGCGAA
CGGCCTTGAGCCCCACGGCACCAGCAAACGCGCCAAAGAGATTCGTCCACCTATTCCCATTAACACAAATACAATACCATTAACACCATATAAATTTATA
AATGAACATTACCATCCACTACCAGCAAAACAAAAGCGCATTTAATACGTACCAGAGGTAATTCCATGACGCCAACACGCCGAGCACGATTTGCGCGATG
GCGATAAACCGAATGCGGTAGGACCGGCNNNNNNNNNNNNNNNNNNNNNCACACGCGCTTCTGGTACTCGAAGCCGTCGTAGCGCGTGAACTTGGCGCCG
CGCGTCTTCTTGGGCTTGGGGTCGAGGATCGGCTCGTAGACGCTGATGCTGCTGTGCTCGGCCGGGGTCATCATTGGAATGGAGCTCTTGACGAATGGCG
GGGAAGAAAAAGAGAAGGGAGGGATGGGTATTAATAATCAACAGGGACGGCGCTTATCGTGCGCAGATGGATAGCGTCTAGGGTCGATGGACAAATGGCT
AAACCGCCAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGATTGCACAATGAGGCACCTTCCTTCCTTGGTCGCC
TTGCGTGAGAACCTTGCGGCAGAGTGCAGACCCAGATCTGAGGCGCCCCCTAATCGACAGTTGAGCATTCTCTGTGTTCATAACATTGTTTCAAAGTATT
ATACTACAAAGGTATATAGTATATAATCAATGGTAGTAAAATATAAGAAAATCATACTTGCACCAAATATGTAATAATGAAGGACAATAGTAGAGGGGAA
AATGGACAAGTGCCCGCCAACGGAATGTTGGTTGTGCAGAGACAAGCCTCTACAAGCAGAAGAANNNNNNNNNNNNNNNNNNNNNNNNAACCCCGCAACT
TGAGTATCTCAGCGCGCGCCAATTGTGGCACACACATCGTCGTGTGTTGAAGTGGCACAATTGGCGTTCTCGCAAACTGCATAATCGTTGTTTGGTTTCT
CCATGCGTTCTCCTTCGTCTTCATCCATCACCAGTCTCTACCGCCCATGTCTGTCTGTATGCATAGCGCCATTGTTATGCCACTGTCTGTCTGTCCGTAT
GTGATACAGCAACAGTGGAAGCATTTTCTGCAGTAGTCCACGTGGCGACTGGCCACCTTTCCCTGCGTCAAAATTTATGAAAAACGCGCTGCTGAACGGA
AGCGTGGCGCCACGCCATGCGACCTCATGGCGTTACTCATGTGTAGCGTCTATCGATGTTTCGTTATGAGACCTCCGACTGCCAAGCGGTGGATGGATTT
GTTGTATGCAAATCTAGAAAGATCGGTAGCTTCAACCAGCAGCGGAGGATTGATATGCGGCTTTTCGTGACGCTTGCTATCTCTATGGTTCTGGCTGGGG
ACATGGTGACAATGCAATCAACTGGGAGCTTTCAACAGCAATCGTGCACGTACAGCTATGCTCGCGATGGGTCCTATGAATGAAGCACGTATGCATTCTT
GCTACTTGAATAAACAAAAATGAGCTTGGTCAAATAAGAAGTTGAGAGAGTTCGTACATCTCATGACTTGATTCCTCTGTGGCCACACACTTTTACGCAC
TCTTTACGCTCTTTATAGTAAAAAGAGCGTCGTCACTAACAACACAATCCATACAAACAAAAATATGCTTCCTCGCTTCTACAGACTGTATCCCATGCTC
CTCGCATCATGTGCAGTGGTACGTCCTTATTATGAAGAACCAGCCCTATTGATCGCATCCATAACAACGCTTTTACATCGACATGCTTTTTTCCATTTCC
AGATCAGTTTCGGCGTCTGTCAATGGTTCCACACGCGCGATGTACGTCGGTCTGTCTTCCCATGCCGCTCTCCTGCGTCAAATTCGTAGGCCACCTACAT
TACATATGCGCATGGATCCGCTTGTGTCTAGGCTCACAACCGCGCGCTGCATGCCGACATGTCGCTCAAGTACATGCTGACGGCCGTGCCGCAGTTGGGC
GCGGCGCTCTTGCTGCTCTACTACGCGTGCACGTTCCACAAACCGTCGAGCGCCGTACAGCAGCAGCTGGTCATCGAGTCCTGCGTGCACCAGAGCATCG
CGATGCTGCTGCAGGCGTCTGTTCTGCATGCGACGTTCCATGCGTCCTCGAGCCTCTGCTGCGCGTTCCCCGTACTCTGGTGCGTTGGATCGCCATCTGA
GTCTGCATGCATACACGCGGCTAATGCGTCACTTTCTGTTCTTTTTAGCCCCATCCACACTGAGAAATGCAACCTCGCAAGCATTCTCCCGTGCCCCACG
CGTCTTCGTGACTTTCCCCACTACGACTTCGTGCCGCGCGTTGCGCAATGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCG