Description :
From Genome Similarity Track
Location :
Scaffold_430:2720- 4083
Sequence
1363 bases(100 bases per row)
ACGATACTGCCCTCAGTGGGCATTTGGGCCAGGAAAAGACTTATGCTTGTGTGAGTCAACACTACTGGTGGCCCAAACTCAACAAATGGGTTAGCACATA
CATTCGTACATGCGAAACGTACCAGCGGGTCAAACCATCAGCACATTCGGCTGCACCACTCGCAAGTTTCCCTGTGCCCACGGGGTGTTGGGAGTCTATC
AGTATGGATTTTGTGTTTGGTTTTCCCGAAGACTGTGAAGGCAATGCGGGAATTGTGGCCTTTGTTGATCGTTTTTAACCAAGATGGCTCACTTGGTGGC
GGTGCCGGATTTTATCAATGGCAAAGGTACAGCTATGCTGTTTATCGATCGTATGTTTCGTCAACACGGGGTGCCGCTGGCAATCATCTCTGATCGCGAC
CCTCGCTTCACAGACAAGTTTTGTACTTCCATCTTCAAGATGCTTGGCACGCGATTGGACATGTCCACTGCGGATCATCCGCAGACTGAAGGTTAGACTG
AGCGAGTTAATCGCGTCATTGGCGACGTTCTTCACAGTGTTTGTACTGAGTCTCCTAAGACTTGGAGCTCGATGCTCCCTGTCATTGGTTTAGCGCTGAA
CAACGCTGTTCATGTCTCTACCGGCTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGTGTTCCGCTCACGTTACCACTACGTGGTTCTGGGATT
GGTGGGGGAGAATATGCTGGCAAGCTTGCTTAAATCAGCCCTACCACGATGCAGAAATAAGTGAGCGAGTTTCTCGCAACGCGCTTTAGGGTCGTACGAT
ATGTGCGTGATGCAATGGCTGATAGCCAAGACAAACAAAAAGAACAAGCTGATGCTAAAGGCATAGACTATATATTGATTCTTATGAAGTTAGAGACAAA
GTCTAACTAAACGCCAAAAACCTACCTATAAATGTAGTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGGCGGGCGTTTACGGTCATAG
CGAAGTAAGGTCTTGCCTATACACTCAATCTCCCGCGCAAGTTGCGCACCCCCCCAGTGTTTTACGTTAGCTTGCTTATGCCATATCATGATCCTTCTCT
CGTCAACCGGAAGGCGCTTGCGCCTGAAAGAGGGACGTCGTCTCCGCTAGCTGCATCTTCGTCAAGAGCTCCACCTGGCCATCCAGCCGTGGTAGGTTGT
ACTTCAACTTCCTCAGTCGCTTGTCGACCGAGTAGATCTAACCGAGACGGTTCATCTGCTCACTCAACTAAGCCAACTCAGTCAATGACTGTTCATGAGC
GTGTTGTACTTGGTCAAGGTTCTTCCGAAGTTGCTCCCTCTCAGTCACAGACTGATCCAGTGC