Description :
From Genome Similarity Track
Location :
Scaffold_670:272- 3670
Sequence
3398 bases(100 bases per row)
AAAAGCTCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGAGCCTCGAGTTCACCGACAGGCATAACACAC
TCGAACAAGCTTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTGTGTATTTAAGCTTACCCTTTCGGGTCTA
TTCCTAATAAGAAGTCATAATCAAGTACACAAATATCAAGTGAGCAATGATCCGTTATGGATCTTCTTGCATGCCAAGCGTCGTCTGCACCGTCGCATGA
GCATCTTTAACGGTCCGCGTCTTGTCCCAGACGGTGAACGTGTCTTCCAAAGGTCGCTGAGTCTTCCGCGAACTCATCCCAACCGCCACTGAGGGTTCGT
ACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAAAAAGGACAGCCTGGATTCAGTGACATAGGGCCGTATCCGATACTTGTTGAA
AACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTAGCGTCTCCGTACATCACCTGACCGAGGGTTCGTCGCTTGAACAACTTGGGCGGTGTCACGTCT
TTGTCGACGGTGATAATCCGCAACTTCGGAGAGATCACTACACCACAACTGCCCCTGTCGCAATGGAAGCCACGGTACTGGTGCCCGTTGTGACATTTCT
TCATTCTTCAATTCACCATCTCGCCACCGTATGTCCAAGCGTCTGAATCGAGCCGTGTCCGACGCTTTTCAGCGTCTCAATCCTCGTAGACGTCGCGAAC
GTGAGCAGCTGGAGGTACGTAAGCCCATCCTTCTCCTGAATCATCGGTACCTTGCTCATCACCTCGTGTCACTCGTCTTATTTCTCAGGAGGGCAAGACC
GAGGGTTCGAACGCCCCTCAGTCTGCTGCACTTCCTTCGACAGCAGCGTCATCAACCGACACTCCGGCGCCCGCTGCCCCGGACTCTTCACTCCCTGTGG
TAGCTCCTGCAGCACTCCCCGTCGTCGCTGAATCCGCGGAGATGGCTCCTGCTGCTCCTCCTGCCCCAGCTGGTGGTCCGCCACCACTCACCGAAGATTC
GCTGCGCGCCCTGCTGGCTGAAAGTACGGAGGCATCGGTCGATCACATGATGACCTCGATAATCCCGTACTTGACTGCAATGGCTCGTCACCAAGTGCAG
CTAAGCGTTGCGCCTCCTCTCCACGGCGATGTACACACTCAACGTCGCCTCGAGACTGCTGTTGGTTTCGATGATGTCCTCGCCGCACGTTCCACGACGT
TCTCCAGCATCTCCGATAACTGTTGAGGTATCCCGCGTGACTTCGTTTTCAGTGGTCGCTCCCCGGTCGGCATTCATGTTTTCTTATTCTTAATCCACTT
CCACAGCGTAATCATGTTCATGTTGTTCTTCAAGTGCATATACAATTTGTTGTTGCAGTAACGTTCTTCGTCTGTTACCACAGGCTGCATCGCCCTGTGG
ACAGTTCATGCGTGATCCAGTCACGCTAGTCTTCGTCCGCCACTTGCGTCATCTGCAGCTGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAG
ACCTCCACATGACAAGTTTGATGATGGTTCCCAAGTTATATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTT
AGTGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCAGTAGTTCCTCATCGAAGTCGA
GTCTTGCTTCATTAGTCGCGTCAAGTACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACAGCCTTGAGTCTTGACACATGCACTACTGGGTAAAA
GCGATACCCACTTCGATCAGGCAGTTCCAGCTTGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGATCCATGCCATCGGTGAGCTAATTTCTTT
GTCAAGCCCGGTTTGACGCGTTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTCCTG
AAGCTTCTAGGGGGTCCGCCGAGTGTTCGTTTCCACTTGGTTGGGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTTGCCCTTCG
CTCCTTTTCTACAGCCTGATAATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGTGTCAGACTGCTTGCCG
AGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAG
AAGTATTAATAGCAAATACTAGCTTCTCCGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCAC
CGAGCGTTCCTGCTGTTCATTAGCCTGTGGCCTATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAACGCTTGCAACACCTCGCTCATG
AAGCGTGGGTCGCGGTCATGCCGTATTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAGCACTTGGGCAACACTCAGTGCAGTCGTATCTG
ACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCAT
CGAGACGATCTGGAAAGGTCGTTCGGCGAGTAAGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTC
ACATGCTTCTCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGT
CGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCGATCC
AAGATAGTGAAGCACGCCGTCTTCTGATAACACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGA
AGCACCTTCTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGCTCCCGCTGTATCGCTACTGGGTCAACATCTTCCG
CAATGGGAAATGCCGATGGTACAGTCTTGTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATGCTCC