Description :
From Genome Similarity Track
Location :
Scaffold_2960:272- 2317
Transcript NameFunction/comments
Phypl_g15520hypothetical protein

Sequence
2045 bases(100 bases per row)
TAAGCGTGTTACTCAGTCCGGCGCTCGTGATGAGCGCAGAAACGGTCTCCAGTCGTCAGGAACCGTATCCCATAGAACGGCTAAGAAGCCGCGGACTACT
TACGAAGCTTCTGTCGCTTCTGTTCTCAGATCACGACAGCCTTCGGACAGTCAGCCTGGAGCCGCTAGATTGGCTCCCAAGTGTTCTGTGAAGGAGGGTA
ACCTCCCCACTTCACtagaagctggcgcttccCGTGGTACCGCCTCTCGCGGACCACACACTCCACATGGTAGTGGGGATTCCCGTTCTGGTCGAGCAGG
ACTGGAGAGGGTCTCTCACGACCACTCCCTCGCGTCGCCTGCTGCGGCGAGTGGCTCGGGACCTTCTCGGCACTCGCATTCGGCACTCGggttgctgcag
cgggaCTTTGGTGCCCTCCAAGAGCGTCTGTACGCTGTGGAGATGGCATTGGACGTTGACCCTGGAGGCCAAATCGCATCTGCAGCTGGACAGCACGGCC
GCTTTGACCGCCTGTGGAGTTACGTCAACTCCCAGCATCGTATGATGTACGATAGGGTCGATCGCCGTGCTCGGGCTGTAGACCTGTCGCGTCTGTCGAG
TCGAGTCGACCAGGTTGCCGACGAGGTCCGTTGACTTCGTCGCCCGGACCAGGGTTCCACGAACCGTGGGGCTTACCAACAGCCTTACGTGTACGGTCAG
TGGGGTGCACCGTACTCGCACGAGAGCTCATCGTACGGAGCTCGGATGTACGCGCCTCCGGCGTACGATCAGCACGAGTACCGCCACGGGtatccgacga
cgacttcgtcgtCCTTTGCTGGGCGCCCGGTGCCAGAGACTCCATCTCGTTTCGAGGAGGTGCACTCGCCTCCTCGCGGtccgcttccgcttccgGCGGG
GCAGCCTGCCCCTGCGGGTCGTGGTACCGCTTCAGATGACCCACATAAAACGTCGGATGGGTCGTCATCGACTTAGGCAAGTCGATCNGGTCCAATGAAc
ctgtgcttcagcttgttgctgccgacTGCACTAACAGTGTTCATGGGTAGGTTCCTCGTATCTAGGAGTACTAAGTCCTCCACATTAAACACGTTTTAGT
TTCCTCTTCCACTTCGATCAGAGTACTCCATTTTCCTGTCCTGCAATGACGCCATAGCGTCTCTAACGCGGCTGATGGCATTCAGCCTGCCGTTGACAAA
CGACGGTAATTGCCTGCGCAATGCGCCCGGTCTCGCCTCAGAGACGTGGGAGGAAAGAGCTTTCCGAGCCTCTCCTCCACTTACGACCGAAGCCTCGGTG
TCCCCACGTAAAGTGAGCGGCACCTGGGGATGACGCATTCCATTCAAGTAGAACGGAGTGAATTCTGTTGACGCGTGCACCGCGTTGTTGAGTCCAAACT
CAATCACGTGCAGCCGTGCTGCCCACGTGCTCGACGCTTCAGCACAGACACTGCGCAGCGTGTCTTGAAGGACGCGGTTATCGCGCTCCGTCTGACCGTC
CGTCTGAGGATGATCAGCAGTTGACATGAGCAACTTCGTTCCCAGTAGCTGGAACAGTGTTTTCCAAAACGCAGCGGTAAACCGCGGGTCTCGATCAGAT
ACAATGGTTTCCGGAAGACCGTGATAGCGGAACACGCAATCCAGGAACAGCCTCGCCGCTTGTTCCCCGGTGATCGTATCGGAAACCGGAGCAATATGCA
CCATCTTGTTCAGACGGCACACAAACACCAAAATACCGGTGTTGCCGCGGTCGTCGGCTGGAAAGCCAAANACTTGCGAAGGTCCTTCTGTGACCTAGGA
GTCGGCCAAGCCGCGATGGCTTTGACCTTCTCCGGGTCGACGCACACACCTGCGCGACCGACAAAGCAACCGAGgaacttgatctcctcggccgcgaACA
CGCACGCGTCGATGTTGGCATAGAGATTGTTGGATCTCATGACCTCTAACACTCGACGGAGGTGCATCAAATGTACCAGATCCAGGGCGCTGTACAACAC
ACAGCCCGCCATGTTGTTCAATAGAACATCCTTGCGCGGTATCGG