Description :
From Genome Similarity Track
Location :
Scaffold_599:272- 1803
Transcript NameFunction/comments
Physo_145192hypothetical protein

Sequence
1531 bases(100 bases per row)
ACGATATCTACCCCTCGTGGGCAGCTGTATAGTTGTAGTACACTACGTTCTCGTATTCCGGTGCGCAGTAGGGGAACTCGGTGTCGTCGTCGACGGGCGT
GAAGAGCTCTTCGCCTGTGAGGACCGTCACGTAGCAGCCCAAGCAGAAGCACACGACGACCACGGCCAGGGCCGCCACCTTCTCCCACATGGGGAGGATC
CCCCACTTCTTCTTGAGCAGGAACACGATCGGCAGGATGGTGGAGTTGAGCGTGATACAGGACGCGCCGACGAAGTCGGAAAGGGCCGAGAAGTGGCCCT
TGAACACGACCGAGAGGATGACCAAGGCGCGATCATGGCCAGACGCAGAACCACGTACTTGATGGCGTTGGCGCCGTGGTATTCGGCAGCTTCCGCCTCA
GCGTTGCCGACTTGAACTTTCTCAGTATCAGCGACAGAGGAGAAGGATCGAGGTGACGGCTTCTCGGCCGGCGTGGACACTTCCGCGTAGCTGAGAAGGT
TGTTCTCGACGTCGGCAACGGGACGTTTGTGCATGCCCAGCACGAGGCGCTCCGTGAGGTAGAACACCGGGTTGAGGATCACGGAGAACGCCACCGTGAT
GTGGACTTGCATGGCCAGGTAGGCCAGCACGACAGCGCCCCAATTGGGCGAGAAGCCCAGCGAGGTGAGGCCGGTCGCCGAGCTCGGGTAGATCGTCCAC
AGGATGTATCCGGAGATCTGGCAGCCCACGGCCGAGTACGCGGTGCTGGCTAGGACGAGGAACAGGACGGAGATCGTGCCGATAGTGACCCCCACGACGC
GGGGCATGCGTTTCGGGTCGCTGTGTTGACGGTGGATCGAAGGGATCACAACGCCCGACCCGTTCGCGAGCGCCAGACTTCCAAATGCTCGAATCACTTG
CTGGAGATGAAGTTCCGGGGCTGGAGCACTCGGATGGCCACACATGCCGTGCACCACAACTGCGATGCCGATGACGTCTGCGACCAATGTGCCCATACAC
CCGCGAATGCAACGCCGGCGCCTTCCTTGAGAGTGGGGACGAGGCATACTGGCATGACGGTGACGGCCATCAGAACGGACCATGTTGTCGAGCTGAAGGC
ATTCGGGAAGAGGCCGTCCAGCAGCGTCCCGCCGAGCACCAGGAACACGCACGGCACGATCAGGCAGCTGGCCATTTGGACGACGACGGTGAGGTAGCGG
CCGCGTGTGCCCAGGACCCACTCGCCCAGGTCGCCGTACGTCTTGACCGATGTAGGCGCGAGCAACATCACGCGGCAGATGACCGTAGCCCCGTAGACGT
TGGCGAAGGCCATGAAGACCATACTAACGATTCCGAGAGCGGGGCCAGCGCGAGAAAAGTTGCCGGGCATGCTCAGCGTGCCAATGCCGTAGACGCAGCA
AAAGAGATTGAAGGACGCCTTGGCGTCCTCCATCGTGATGAATGCCATGGCGTCGAAGCGTCGAGTCGAGTTTCAGGGCGATGGAACGAGTTGGTTGGCT
TCTTGCGAGGAAGAGTGAAAATCGGAGACTG