Description :
From Genome Similarity Track
Location :
Scaffold_287:27199- 28565
Transcript NameFunction/comments
Phyag_g4331conserved hypothetical protein

Sequence
1366 bases(100 bases per row)
CGTTTACGGCAGGAAGAAGGCCTCGAGGGCGATAAATTAGGTCTGTTATGGTGCGCTGGACTGAAGGATGTCCGTAATCACCTCGTGTCTACATAGTTCT
ATGGGGGTCTGCTGTCGTTCACATGACCCGCTGGCGCTTGAGAGGGCCGTCGCACGCGATCGTGGGCACCGCGCAGCGTTCGGCCTCTGCGGCCTGGTAC
TTGGTCCACAAGCGAGCCATCAtggcctcctcctgtttCCGGCGGATGTAACTGCTGTGGGCGGGCAAGTTAGCCACGGCTAGACGCTTGGGCGCGAtcg
gcgctgctgtcgactcGGCGAACAAGCTCGGGTCCAGCTCGTTTAGGTACTCGTCGAGGCTGCGGATGAGCACGCGCTCGgacgattgctgctgctgcaa
ctcaagctgctgctttcgcTCGAGGAActcctggatctcctcgtACTGCCTGCGCGAGCGACTATCGTGCACGCCGAGCAGTTGGCTCGAGGTCTCGTCG
AGGCCCCCGACCTGCGCGCAGATGTACTGCTGCACGTGGTCCATCTCGGCGCggtactgctgctccttggcgGGCGAGGCGAACTGCAGCGGGCGCCGCA
CGGTCCGGCGAggcttggagctgcttgtggtAGTGATCAtctcggtgctggtgctggtctCAATGCAAATGATGGAATGCCACcgagctccaccgctgcT
GTCAGCACCGAAGTCCTACGGCTGTTACTGCCGCTTCAAGCAATGCGATTTGCCCATCTCCGCGTCGGCGACGATGCGACGATTAGGTACCAATCAGGGC
AGCTAGTGGATTCTTTTTTAGTTACCTACACCTGAAAGATAAAGGCTTTTTGGAAAGGAAGTTGGATTGGACTGACAAACACAATTGGGTGCGTACACAC
GGGGGATAGAGAGATGCAGGTAACGATCATCACTCTCACTCGCGTGTCATCTGGTTCTAAAACATCGGGAAAAAAGAGTCGATTTTTGAATTTCCGGCCC
CATACAAACGTCGAGAGATCGCCAATTTTCGAGTAAATTGTCGCCGTGTCAGCGACATCTTGGTCGCGATCATGTCGGCGAGTTACCTCGATTTGCTGGG
CCGGGGCTGGATTGTATCGCGCCGACGCCATCTTTGGATTTTGACGCGTGGCGGACACTTGCGGTGATCACTGGCAGGCAGGCGACGAACAGCGAGTGTG
GGTTCAACACTGTCCATCGAGTGTAAAGCAGATCGGATCGGGGCGCGGTGCAAGTGCTCTGCTaaattgttgttgctgagccCGTGCGACTTCGGTATCA
GATGGTTGCGAGCTTCGTTTAGCCAATTGGCAGGTCCCAGACCTGCCCCGTTCGGCTAGGGCTTTG