Description :
From Genome Similarity Track
Location :
contig_28:271923- 273272
Transcript NameFunction/comments
g5630.t1hypothetical protein PHYSODRAFT_320526

Sequence
1349 bases(100 bases per row)
TGGTCCACCTCGCAGATGAACCTGTCGCAGTACAACGACACGGACGAGTGCAATGCTCGCCCCGTGGCCGACGGCACGTGCCTCATGTTCCCGGGCCACT
CGAAGCTCGAGTGGACGTTCGCCGTGAACGCGTGGATCTTCGGAGCCATGGTCGGGTCGCTGTGCTGCGGCCACTTCAGCGACAAGTACGGCCGCAAGAA
GACGCTCATGGGCAACTGCCTCTTCATCATCGTGGGCGGCGTCGTGCAGACGGTGGTGTCCAACATCTGGGTCTTCTCCGCTGGCCGCCTCATCGCTGGC
CTGGCCTCGGGCACGGCCACGGCCACCATCGGTAGCTACGTGAACGAGTTGTCGCCGCCGCACATGCGCAACACGCTGGGCCTGGGGCTGCAGATCTTCA
CGACCATCGGCATTTTGTTCCCGGCCATCGCCTTCTTCTTCGCCAACACGAGCTCTGGCTGGCGCTACCTGGCTGCGTTCCCAGTCCTCCTGGGAGTGAC
CTACCTGCTGCTGGCGCCAACGATGTGCGTGGAGAGCCCGGCGTGGCTACTGACGCACGGACGAAGCCAAGCAGGTCATCGCCCGTCTGTACGGCGAACA
GCATGTGCAGACTGCGCTGTCGTGGCTGCAGGTGAAGCGAGAACGCCGAGGAGGGGCTGGCTGCTCCCGCGAAGGAGTCGATGTTCAACCCGCGCTACCG
TCTGCAGCTGCTGGGCGGCGTCCTCTTGTCCTGCGCGCAGCAGCTCTCGGGCATCAACGCCGTCTTCTACTACTCGGGCAGCATCTTCTCGGACGCCGGC
ATCTCGGACTCGCGCGTGGGCACGCTCATCATCGACTTCATCAATATCTGGCCCGCCTTCTTCACGGGCGTGCTGGCCAACCGCTTCGGCGCGCGCAACA
TGATCCTGTGGGGTCTGGCCGGCATGGTGGCCATGTCCATCGGCATGACGGTGGCCTTCATCGTGGACGTGTCTGCGCTGTCGATCGTGTTCACGGCGCT
GTACGTGATCGTGTTCGGCGTGACACTGGGCCCGCTCGTGTGGGTCATGACGGCCGACATTTTCCCGGACTCGATCCGTGCCAGCGCGTCGTCTTTCTGC
ATCGGTATCAACTGGCTGTGCAACCTCATCGTGGGCGTGTCGTACCCGTACATCTCGGATGCTCTGACCGACTACGCGTACGTGCCGTTCGTGGTGCTGC
TGGCGATCTTCTACCTGTTCGCTCTGAAGCTGGTGCCGGAGACGTCGGGCAAGTCGGCCGAGGAGATCCAGGCCGAGTACGATTCGCGCCGCGAGAAGTA
AGTGCCAAGTGTAACCAGTCAAGAGATAGCGTGCTTTCGAGCGCATGGC