Description :
From Genome Similarity Track
Location :
Scaffold_181:27186- 34880
Transcript NameFunction/comments
Phyta_totarag5179hypothetical protein PHYSODRAFT_470076

Sequence
7694 bases(100 bases per row)
GaaagtgtagccatgtctaTTGATCTGCATCGTATTTAGCCGAGACTCGGACCAATTCAATGAATTGCATCTTACAAATTCCAAGTCTGTTGGAAATCCA
TAGAACTACGCTCCGCGCCATTTCGCGGTTTGACACAGTGCGCGGATAGAGCGAACGCCAACGCGAAGAGTGCGCTCTGCTAGGCCCGTCGCTGCGAAAC
CGTTGGCACTAGCCCGCGATTCACACTCCACTTCTGCTTCGTCTGCGTGTCAAAGTGCGAAGCTCATGGACAGTGGCGCCCCCGACCCCAGTACGTCCTC
TGAAAAGCACAGAGAAAACGAGTGGCAGAGGCCGTCGTCTAGGTCTTTTGTGTCTCTTCCTGCGTCTTGTTCGCGTGCATTTTGATGAACTATTGGATGG
CAGTGCTCTAACGACGTTCTGATGGGTTGCTCGTGTATTATTGCAGTCGCTGTGCCCGCCAGCCAGCAGGATAAAGCGCCTGCAGCGACCCCAGCGGTAG
TTGACGCTTCCGAGCAGAAGATTAAGGTGACGGAGCCAGAAGCAAGTCCTAGCACGGATGTGGTGGACCCGATAAACGATCAGGCGAAGGACCAGGCGAA
GGACCAGACGAAGAGCGAGGACAATGGCAAACGTCGCAAGCGCCGCACGAgcatgaagaaggtgaaatacgtggaagaagacgacatgTCGGAGGGAGAA
GAGGCCATCGTTGCTGATAAGAAGAAGCGAGCACAGCAACTGGACTACCAGTTGAGAACAGTACGTCGGTTGTCGGacgttgcagttgctgcaacttgaa
gGGCGCATGTTGATGTACTGACTGATTAATTGTTGTTTTTGTAGGATGTGGACTACCCGCAATTGGACCAAATAGTCGGTCGACGGATCAACGAGTCGAC
GGGACTAGTGGAATACTTGTGCAAGTTCCTTGGTCGCTCTTACTTGCACCTGTACTGGCTCACGTttgacgaggtggagctctTTATTCCAGAAGGGTAC
CAGAAGTTCCATCGCGTACACGTGTATGATCGAAAGCTGAGACGCGATGGATACCAACCGCTGGATGAGGTAGACGATCTGGAGGCAAACAAACTGACGG
TTGAGAAGATTTTGAACCACAAGGTGGACCCGGCCGACCATTTGGACGAACAGATCGAAAAGCGCCGACGCCAGCTGCCGTACGAGCCCAAATTTCCACG
TGTGACAGACTATTTCTTGATGGATAACGCCGACGTGATTCCGGAGCGCATGCTGGGCATCGTGACAAAGCTGATGAAAGAACCGGGTGGCGACGTCTTT
GAGCACCCTGTTGATGTCGAAGAAGTCCCCGATTACCTCAATTTCATCACGAACCCTATCGATCTAGGAACGATTTCCACGCGACTTGGTCGGGAAAGTT
ACTACATTGGCTCATCGGCCGTGTCATTATTTGCCTCAGATGTGCGACTGGTGTTTCGCAACTGCAAAATGTACAATGCTGAGGGATCAGTCATCTGGCG
TATTGCAGACGaacttcttcgctgctttGAGAAGTGGTTGTACGATTGGGCTCTTTCTCCATCGGCATGGCTGAAGCTTCCGTCTACAGGAGACACCAAG
GAAGACCAACAACTCCAGAAAGAGTTTCGTACGGAAGCCGAAAGTTTTTATGATGTATGGGCGCCTTGGCAGATCGGCTGTTGCGTGTGCGGGAATAATG
ATCACAGTGAGGAGCTTTTGCTATGTGACCGATGCGATGGTGAGGTTCACATGCACTGCGCCAGCCCGAAAATCACGGAATTACCAGACGGTGAGTGGTT
TTGTGGGTACTGTCAAGCACGTACAAAATTTATtgagaagatggagaaggtgcagcaggaaAATATTGCAAACAAGTCTAAAACCATCGAGACAGAACCA
CCCGCTGGAGTAGcaggtggtgctgttccTTCAGCCTCCAGCGCAACCACAACTTCTCCCGCGGGCAAAAAGACAGCTACCTCATTGATGCATACCCCGA
ATATTCTTATGGAACGTGCCGATGGTGAAGGTAAAGTTAACAAGAAAACGTCTAAACGCAGTCCCAAAGGTACCAATGCTACAAAGAGCTTGGCGCCAAT
CAGTATGAAAGATCGTGCGGCCACCTTTTTTCTGGTCAAGTGGGTTGGTATGTCGGTTCGATTCTCAACTTGGGAACGGCCTGAGGATATTGGTGACGAT
GAGCAGATCCAGAGGTATTTCAAGTTCAGCCGCGTTCCTAGTGCGAAGGAGATAAGTGAATCTACGTGCCAGTTGCCATGCTGTGTCAAGAGGCACCAGT
ACGCGCTAGCAACTAGCACAAGTGGAAAGAAATGCTGTGAAAGAGACCACTTTTGTACTTTGGGGTACGGTCACGAGGGTGATTGCAGCCGTAGTATCAA
AGCCCTGGGAGGGGCCtatggcagcagcgcgtatCAGCGATTGCACATGGCAGAGCAGGTGAAGGCACAATTGTTCGCCTTCCATTGCTTGCTGAACAAT
CACACGCCCGACAAAGATGTGCTCAAACAGTGTGGCGTGTACACGAACGCATTCGTAACAACGAAACAGTTCTTGGCACCCAGGGCTTCCaaagacgatg
acgatgaagattactcggatgaagatgaggatTCATctgatgacgatgccgacTTCGATGCTGAGTTTGAGTATCCGAATCGGCTTGCTCTTTATCCAGG
AATCCTGACCCTTGagaatgacgacgacgatggcgatgaCGAGGCTGGAGGTCACAAAAAGaaaacagaagaagaggtcAGCGAAGTACTTAGTTCTCTC
GTTGAGCACGTTGCTCTCAGATACCCCACCAAGCTGGAGATCGTCAGTGCTGAAGTTCGGTTTGACTCGACATATCCAGCGACAGCTTTCAAGAAGCTTC
CAGCCTTCACAGAGTACTGCGTCATTCTGGGTCGATCTCCATTCGGTCTAGGAATGCGTCTTGgaatcagcagcaccagcagcgtaTCTGTTTTGGGATT
CCAGATTCTCGCGAATGGTATGATGGGCCCAGCCCAGGCATCTGGAGCTATTTCGATTGGTGACGTGCTTGTCGCTGTGAACAACATTTCAGTTGCCGGT
CTTTCGTTTCAAGGTGTCGTCGGGTTGATAAGTGCGTCTCCCAACCAAATCCTTTTCCACTTCCATTCCCCTCGACCCGCGTTCATGTACCCCCCGTACT
GCCAAGCAAAGCAGGTAACAAAGATTCGTTTGGAAAAAATTCCCGATGATGCGGCTCCAGACAGCTCTAAATTCGCAGATTTTAGTTACAACAAGTACAA
ACGCATGCTTAAAGTGGGAGTTGCAGAACCGGGTGTGGCAtcatcagcttcgacacAGACGTTGATGCAACATTCCAACTACATTGCGCCAAGCGGTCCC
ATGCAACATCTATACGCGGGTGTAGTCGACAACAGTATCGATCCACACGAGCATTTCGCGAGCTTCCTTCCGGAGAGGAGCAACTCGGCAAACGGGAGGT
CGCACGGCAAGAGTGTCGGTGCAAGTGATCGTGGAGATGTAAACGAGTTTGTACCGTATGAACAGTCACCAACATACAAAGGTGGCCGTACGCTGCGATC
TTATCAGGTTGAAGGTCTCAACTGGATGGTATCGTGCATCAAAGCTCAGCGATCGTGCATATTGGCTGACGAGATGGGGTTGGGTAAGACGGTTCAAATT
GTGTCGCTGATTGAGCACATGAAGTCAGAGGAGTCCATTCGTGGACCATATCTGATTGTCGTTCCACTTTCAACGATTCAGCATTGGCGCCGTGAAATCG
AGAGTTGGACAGATCTCAATGTCTGCGTTTATCATGATATTGGAGATCGCACCACCAAGTTTACTGCTAAAGACATGCGTGCAGTCATTCGTGATCAAGA
ATGGTACTACCCGGGCTTGGGCAACTCGATCTTCAAGTTCCACATTCTGCTGACCACCTTCGAGACCATTCTGGCGGATTTTGAAGAGTTTGAGCACATT
CACTGGCGCTTGGTCGTAGTAGATGAGGCACATCGATTGAAGAGCGCCGGGTCACGcgtgctgaagatgatgcgCGTGCTTCACGTGGACCGCAAGGTAC
TGCTGACGGGTACACCTTTGCAAAATAACACACAAGAGCTCTGGGTTTTGCTAAACTACCTAGAGCCTGTTAAATTCGCAAGCTTGGACGAATTCAACAA
GAACTTCGGAAAGCTACATTCGCAGGAGCAGGTCGTCAGGCTTCAGCAACTACTGGCACCGTACATTTTGCGACGAGTAAAGGAGGATGTTGAAAAAAGT
ATTCCACCCAAAGAAGAAACAATCATCTCTGTGGAGCTAACaacgctgcagaagcagtaCTACCGAGCCATCTACGACAAGAATAAGAGTTTCCTGTACC
GCGGCACGAAGAATGGTTTACCGACGCTGAACAACATTCAGCTGCAACTGCGAAAATGCTGCAATCATCCATTCCTTATCAAAGGCGTTGAACAGCGGGA
GTTGGACGAACTCAGTAGCAATCCAACACCGGCTCAAGTGATGGAAAAAACGATCGAGTGCTCCGGCAAAATGATGCTCGTGTCCAAATTGATCCCGAAG
TTAAAGCGGGATGGACACAAGATTTTGATATTCAGCCAGTTTCTGAAGCAACTAGACTTACTCGAGCGCTACTGCGATGCGAATTCTTTTGTGTACGAGC
GTTTGGATGGTTCTACTGGCGGAAGCATGCGCCAGAGCGCGATCGACCGTTTTTCTCGACCCCACTCGAAGTCTTTTGTGTTTTTACTCAGCACGAAAGC
TGGTGGTGTGGGCATCAATCTCATTGCAGCAGATACGGTGATTATCTTCGACAGCGATTGGAACCCGATGAACGATCTGCAAGCCCAGTCGCGTTGCCAC
CGTATTGGTCAGAAAAAGAGTGTACAAATCTATCGCCTAGTGACACGCAACACGTACGAAAGCGAAATGTTCGACCGCGCCTCACGAaagcttggtcttg
agcaCGCAGTATTAGGTACGGCGTCCTTCAATGAAAATTCACAGATCACGAAGCCGTCAGCGGAGCAACTTGTAGAGCTGTTGAAGCGCGGAGCATACGC
GCTTATGGAGGACGATGATACTGCGTCCAAGGAGTTTGCTGAGCGAGATATTGAGACCATTTTGAAGGAAAATGCTCGTGTTTTGGTTGTAGGCGGTGGG
TCCAATGCTAACAAGGGAGCGGATGGCGATGCGGGTGGGCTGACATCACCAAGGCATAGAAAGTCTCCTGTGAAATCTCACAAACGAAAGTCACTTGGCG
GAATGGCGGTAGACCGCTCATCCTTTGTTGCCGAGGGATCGACCGGTGAACTATCTGTGGATGACCCGAACTTCTGGGAGAAGGTTCTTCCGGGGGCCGT
CTCGGTGGAAATgctgagcttgaagctggaagaTGGGAGCGCCGTGAACTCGCGTCAGTCGAAGATAAAGTTTATCAGCAATTTGGACATTGCTTTGACT
AGCTTGGTTGCCGAAATGAGTTCAGGCAACAATTCTGACGATGGTCGAACTGGGAGTCGAGACATTCAACACGAGTACGATATTGCTATCCAGGTGCTGA
ATACTGTGAGCTCAAAATACCATGATGAGTTCTCCAACGAACAGATCGATCTCGTGAAGGGATACTTATCAAAACTGGAAAAATCACGCGTGCGAAGCTG
TCGACTAGCTCCGACTCGAACAAACATGTTCCAGGACGAATACTTTGATACCccaaagaagaaaaagcgaAGGAGAAGCACCCCAGCAGGCAGCAGGGCA
CCAAGCAGCGAGGATGAAGCGTACGGTGATACTCctgcgaagaagagaagcagTAAATACCGTGGCCGCCCTCCAAAACACCCGAGAACCGAAGACACTA
AGCCCCCAACGGCTCTCTTCCAAGCTGGCGTTATTAACGAGAGCGATGATTTGTGCACTCTTTGTGGTGACGGCGGATTGATTTTGCTGTGTGATGGCCC
ATGTCATCGCTCATTCCATCTCGAGTGTGTGGGCATGAACGATGAGCCGAACGACGAGCAGTGGTTGTGCCCAGATTGTGCTGAGGGACGTCATATGTGC
TTGATTTGCAAGCAGGTCGGCGAAATGGGTGTCGAGTTTGGTGTAACCCAATGTTCGGTGGCTAAGTGCGGCAGATTTTACCATAAAGGCTGCCTAGCCA
AGAATTCGCGCGTCGAGTGGGTTGGTAAGAAGCGTTTCCGTTGTCCGAGCCACTTTTGCCATGCCTGCTCAAAGAGCAAGACGGATACTGCCACTAAAAG
CAAAAAGAAAAGTGACGACAAGACAGGTGTTGTGAGCTGTATCCATTGCTCACAAGCCTTCCACCCAGATTGCATTCCATCAGCAGACAAGTTTATACGG
CTTTCAAAGAACCTCATGATTTGCGCAAATCATTTGGACGGGAAAaagccaccagcttctgcagggCAATTGACTGGATCGAAACCTGCAGCACATCGCG
CTGGTGCAacactcgctgctgcggcggctcAGCAACGGCATGAAGTTCCAGAGCCGATTCCTCTATATGAAGATGACGAACCCGAAGAACCCGAAAAGCT
AAgcggcaagcgcaagcgtgCGTCATCTCCAAAGAGGACCAGCACGAGCGGGCCGAAGAAAAGTAAATCAGCGCATTCGGATAAATCGGCTGCGAAACCT
ACTCAGCATAAGGTCTGCGCGCTATGCCACCGCGGAAACGTAATGGGaggcggtgctgctggtcaagaaTTGCCATCTCCGGCTTCAGCCAAAAAGGGAG
CGCGTAATGGAACTGCGAGTGCAAGCGCAGACTCAACAGGGACTGCTACTGCCGATATGGCTCTGGAAGGGCCCTTCATCGAGGTCCCTGTTCGTTTGAA
ATATGCTGACAAGCCCAACGAGTCGGTGTATGTGCACTTAAACTGTGCCGTACACTCACCTGAGGTATACGTGAAGGCCGATGGTCTCATCATGAACTTG
CCTAAGGCAATTAAGCGCGGACGACAGCTCAAGTGTACCGGTTGCCACAAATTCGGTGCCACGGTGGGCTGCGTTGTGTCCAAGTGTCGGCGCAACTACC
ATTTGCGTTGTGCGGTGGAGAGCGGCGGTGAGATTGATGGGACCACGTACGCTCTGTACTGCAAACCACATGCAGCTGCGCGCAAAGGGCCGACGCGTGT
ATGTGTGTGCGATGCCAATGAGGAGGACCCGAAGCTCACGCTCGTGTGctcctcgtgcagcaccaagttTCACCCAAAGTGCGTTAACATGTCCGATCGT
CACGCGGCTCGTAAAGCGAAGACGTGGGTCTGCAGTGTTTGTGATGGCTCAGCTGCGGCGAAGCCGGCGACGCCAACTCACATGCCCGCTTcgaaggctg
cagcagcatcaaagaAGCCGGCACCAAAGACCAAGTCAACCAGCTCGAAGGATTCGTCCAAGGCAACTATCAAACCGGcgtcaaagaagaagagcaatgG
CAAGGCTGAAAGTACTGACAGTAACGAATCGGCGTCCACGCCAAAGCgcaagaagccgaagaagaacCGCTTGAGCATGCCGCGGAATAAGTCTCGTCCG
AAGACGAACGGCACGTCTCACGGAATTTCGCCCCATATGGAGGCCGACTCGGATAGCGGCGTCTCCACGGACGAGTaggacggagaaggagaaa