Description :
From Genome Similarity Track
Location :
Scaffold_198:27184- 28201
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_198-snap-gene-0.26Conserved gene of unknown function

Sequence
1017 bases(100 bases per row)
CTCTCGTTCAGTTTCAGCAAGCTCACGGAATCTCGTTGTCGACATCCTGCGCGGCATCGTGCTCTTCTGGGTGGCTGGCGCTTCCCTGTAAATGTAAATG
TATGGAGCGTTAGTCAATCACCAAACCAATCTTCCTTTATGAGCAAGCAATGGTCTTACCTCGATGAGTTGGACAAACCCTTCGACTTTTTAGCATTGCG
TGTGCTGCTCAGCTCTCGCAAAACCAGTTCGTTCACGCTTCCCACCGACACAGTGGTTCCAGTGTCCAAATTCTTGATGCTGAAGTTGTTCTCTGCGACT
TCGGCGGGCAGCTTGATAGGAGTAGGCTCATACTTTTCGTAGAATATTCTGTAGAGCGAAGGGCGATCGAGAGTCTCGGAGTCGATAGTGATCGAGCCAA
CATCTCCAGGTGGGATGCTGAAGTTCTTGGACACTTGGAGCCACAGAGGGACCTCCGAATTCATATCAATGACACGAATTCGATCCAGCGAGCTGTGGCC
AGGTGGAGCTTCAAAGCTAATCTTCAGAGGCTTGCCTAAGTCACAATGCTATCAATGCCAACAAAATCCGTCGTTAGTCTGTGCAGGATTAGCGACTTAG
CGCAGCAAGGTAAAACATCGTACTGAGCGGCATTTCACGCTGTATCCCGTCTTCTTTGCGTGTTTGCGGAAAAAGTCCCAGCAAGACTTGACACTCGCTT
CGTGCTGAAGCTGTTCTGTGTGCTGCAATAGACTCTTGGCGCGAGCGACCTTGGGGATAATGAAATCTTCTGGACCGTAGCCATATGGATTGTATTCCAC
TCGAGCACCTCTGCATTGTACATGAAACAAGAATCAGCGATTAGCACTTGTCACCATGCAATTTTTTCACGTATTTAGCCTGGCATTTTACCGTCGAATC
AGTTCAGTTGCTACGTCAAGCGCTCCACTGGCACTGCAGACAAGAAAGAAAATCACTGTGAGCCTGGGTAACGGGGCCAAAATCACGACCAAAGAGTGCT
TACCAGGCGTAATGCAA