Description :
From Genome Similarity Track
Location :
Scaffold_37:271825- 274113
Transcript NameFunction/comments
g9293.t1hypothetical protein

Sequence
2288 bases(100 bases per row)
CGCACCTGATCTCAAGTTTAAATTGCTCTCGGTCCGTCAAGCTGTCGAAACGGACTACAAGATCAACTTCCCGAACACCAAGAAATGCGTCCTGTTCTAC
GACCGTGGAACCAAGTTCGAAGCCAAGACTGGCAATGGCACTCGCTTCGACCAATTCGTAGCTCGCCCGGTGAGCATCGACCACGCAGCCCATGTGGCCA
AATCTGGTACGTCCGATAATATGTTACTCTGGCACAAACGAATGGTTCATCCTAACTTTCGTATTATGCGGGATCTGGCTAAGTTGGACGCCATCACAGA
CATGAGGATGTCGAAATCCGACTCAAGCAAGACTACTTTTGCTCTTCATGCACATACACTACGGCAAGGCACATCATAACCCAGTCAATAAACGTACCGT
TGAAGGGCAAAATCCCCTCTTGAAAAGGTTCATACAGATATGGCTGGGCCCCTTCCTGTGCCAACACTATCAGGCTGTCAATATTTCTTGACCTTTATTG
ATGACTACTCGCGCAATGTGTGTATCTACGTTATCAGGCGCAAGTCAGACCTGTACGTCTGGTACGAGGATTTCAGAAAGAAAACACAGAACATGTTTCG
CGCTGATGTGGTTCACTTAGCATACCATGCTGACATGCACGATGAAGAGATCCGGAGCCTCCAAAGTGACAACGCTCGTGAATATGAGAAACTCGGGAGA
ATTATCTTCGAAAAATATAACACACACACACAGTTCATAAATGCATACACACCACAACAGAATAGCGTGGCAGAGAGGCGTATGCGCACACGTCTTGAAA
GAACGCGAGCATTTCTGGTTGACGGAGATCTTGCCCAACTCCTTTGGGATGAATGCAACACACACGTCGCTGATCTCCTCAACGTGACCCCGAGCTCGGT
CACAAACAGCGTTACCCCCCCCCCCTATGAAAAATGGTTCAAAAAGAAACCATCAGCACATTACATTAAAGTGTTTGGCTGCACGGCATACGCTCACATC
CCAGAGCTATACCGCAACAAACTCGACAAAAGGGCTAGAAAATGCATGTATCTGGGAATTCCATCCGACAAGAAGGGCTACAGGCTCCTAGATACGACAG
ATAATCGCATTGTTTACAGCCGTGATGCTCCCTTCCGCGAACATGAATTCCCCACGCTGGATTTTCTCGATCTACAGAAATCAACAGACATACTTAGCCC
TAAAACAGGCACTACAGTACCAGCACCCATTCAATTGCCCTCACTGTCAGCAATGCGAAAACGCAATGCTAATGCACTTGCTGCTGAAGATACAGAACCA
ACACCTAAGAAAGCAAAATCTCTCTTAGAATGCAGATGTACTGATCCAGTAACAACCTTGCTCAATGGTACCCTCGATCTAGAGGAACGCGAAACAAGTC
GCAACGCCCTCCACACACTACTTGCTATCAGGCATATATCGGAGCCAAAGACCTACAAGGCAGCCATGCAGCTGCCAGAAGCTCCTCACTGGAAAATAGC
CGCACGCTCTGAGTACAAGTCTCTCATGGACAATAAAACGTGGATACTGACCAAGTTGCCCAATGGCAGGCGTGCATTGCAATGCAGGTGGGTATTTGTC
GTCAAATACAAAGGCGACGGCACAATAGATCGCTACAAAGCTCGCCTAGTTATTAAGGGTTTCCTCCAAAGATATGGAATTGATTATGATGAGATTTTCT
CCCCTGTCATCCGCATGGAAGTCCTACGACTGATACTTACCATCGCTGCTTTATTGAATATGGAAATCCATCAGATGGACGTCAAAACCGCATTCTTAAA
TGGGCATCTAGATGAGGAAATATACATGGAACAACCTGAAGGATTCTTTTGCCGAGGTAAAGAACACCTCGTCTGCAAACTGATGAAGAGTCTATATGGA
CTCAAACAAGCCCCTCGAGTCTGGTACTTGACACTGTGTGACTACTTAGCTACGATGAAGTTTCGCAAACTTACAAAAGACCAATGCGTCTTTGTCGGTG
AAATTGACGGAAAAACATGTTACATTCTTGTCTACGTCGATGACCTTCTCATCATTGCACCTACAGTCGACATTGTCACATATATCAAGGACGCACTGAA
ACAGCGCTTCAAAATGTCCGATCTGGGCGAAGCCCAATACCTCTTAGGGTGGTCCATTGTACGCGATCGAAAAAATCGCTCCATCTTCATACACCAAGAA
AAATACGCTACCAAAGTCCTGGACCGCTTCTCCCATCTAAACTCATATCCAGTGGAAACACCCACTGATCTGAGTATCAAACTCTCTC