Description :
From Genome Similarity Track
Location :
scaffold_40:271818- 274165
Sequence
2347 bases(100 bases per row)
CGGGACGTGGTATTTCGAATAGCTCCACGCACAGGACAGAATACCTTTGCATTATCTTTGAGTGTTAAGTGTTAAGATTATAAATCAATCCCTTTTCGCT
ACGACCGTAaaacggtccgatgtagCGCGGTCGAAGCTTAGTCTTAATAACCacagacactgcatgtgtatATTTATTTTGTACCAAACCAAAACTTCTG
CCGCATCCATATCCAAGAGTGTCCTGCCATCGGCGTGTTGCTTGTGTACATCCTCGCTCTTAGCCATAACATCGCACACCCTGCGCTTCGCGCCCGTTCT
CATTGAGGTAGGGCTATAGTCACTGATTTTGCCACAAAGTGCAGCAAAGCTGATATGAGCACTTCGAATTTGACCGACATCCCTCCTCCAACTAGGACCT
GAGCTATTTCATAGTGGTTTGAGAGGCACCCAGGGTACGCCATCTACTTGTGTAATATTGGGTAAGGGCTGTAGAGCCAACGCAAAATCAATGAATGGGA
GCAATTCGCTCCAGCTCCGCGGTCTCTCCGTGCAAGTGCTTTAGAAAAATATCCTTGAAAACGCGATTTATGCTTCCGTCCGACTGTCTGTTTGCGAATG
GTCGGCAATTGAACGTGTTCAATCTGGTGTCTAGTAACTTTAACAGAGTtcgacaaaattttgaacTAAAGCGCGGATCTCTATCAGAAACGATGGCTAC
CGGTAAGCCAAGCTGATGAAACAcgttttttaaaaaagcttGGCTGTACTCTCACCGGTTATTGtattgctgacagcagcaaaaattgaccatcttgctc
atgcGGATCACAAATACCACTTTATGGTTTGCCAGCACTCTACCAAGTTATGCAGGCTGGTCAAGGGTTTTAACCCGTTGACACACtccacacgtgcgca
cattaGAGTTTATCCACTTATACTTGGTGGCCACCACGTCATAGCGTTATCCGAGCAGTATGTATTCTCTCTTTCGGGGTGTCCACCTTAATCGGTATCT
TGTTCCTTGAACAGTATTATGTGCTAGAggtcctcatcgtgaggcacCACTACAGGCTGAGTGTCATGTGCGTCAGAGttgtaatacagcaagcgTTAAG
ATAGAGCATAGCGGCGCAGGCGTGAAGCCGCGCGCATTCTCAACGCAACATATAGTTCTTAAATCTATTGATTTACAAAGCTTTTAGCAACACAACTCAT
GCCGCGTCTGTACACTGCACGGATCGTCTTGTCAATTTGCGATTTCACTACCGTGAGATGCTATACTTCATTGTCGAGGAGACACGAAACCGCACCCGCC
ACTCCATCTGACTATACCTTACTTTAAGGGTATACTCGGCAGTGAAGGACAACTACGTTGATATTCTCTGTAAACTATGAGGTGACAACGCCGCTGCGCG
ccatgacgcatgatccgtGTAGATTTCTAGATGTGACAGGAAGATCCTCAACGCAAATAGCTCGTTCTGATGGACAAAAAAGTTCTTCTTAACTGCTTTA
AGATGGTGAGACACAAACGCAACTACGCATTAGTGCTCATTGATATGTGCATGAAGTAAAACACACCCGTGTCAAAGTGTCACCGACAACCTAGAGAAAT
CAAGAAGCCAGAACCAGGAGAAGGACGAGGCTTTTGCTCGTAGCCTTAGAAATTTTTTCTACTGCCGTGTCCCAGCACCATTTAACGTCTTCTTTAAAAA
GGTTGGTGAGGAGTCGTGTCACGTCAGCATAGTTTGTGctttttgtgcaagtaattggcccgaccaagccactttctCAAGTCTTTTGGAGCGTAGCACT
GATTGGTTTTACGATAATCTTATCCCGGTGAGATCTGACCACAGGAACTGCTTCCAATAATGAAAAGAGGAATTTcgtcggcgccgaagatgcgctTCGA
TATTGGTGAATAGCTAGCTTGAGCGCTGTTTGCGTGTGTCTGATGTGGTTAGTTAACCGGCGTTAGACACATTTATTGACAAATATATCGCTGGAATGGG
TCTGTGCACAACTTCGATGTGGCTTGAATATCTGCAACACCACATATCTGGTGCATTAGACAGTCTCTGTGGCATAATCGACCACTCCAATAGCATCCGC
TCGGAGTAGTCAGCACAGTGAGAGGGATATCTCACTGTAGTTCACCAGCTGTTTAAAGCGTTTTTTAGCCAGGTCGAAGTCACTGAACGTAGTATACTGT
ACCGTCGCACATTTTTGAAATCGAATTTGCGCCGGAACCGTGATTGTATCTAACTTATTGTGAGCAAACACAATTTAACACTTGCCGTTAGACTTTCTGA
CAAAACGGTCGGCGCCGAATGTAGCAGAGCTTTACGTTTTCCCACCA