Description :
From Genome Similarity Track
Location :
Scaffold_245:27178- 28655
Transcript NameFunction/comments
Phyag_g3909hypothetical protein

Sequence
1477 bases(100 bases per row)
GTTTCCGCTCACAGTGATTCCCTGGGTCGATTCTGTCAAAAACTTGTTCGTCGGTATTTGCTTCCATTTTGATGGTAGCTGTGTGCCCACAAGCCCAAAC
CACTCCTTCAATGGGCCctttccttctccttcttcgacCCGGACTCCATCCACCAGTTTTTCACCGAACGAGCTCTTGAAGAATGGGAAAAGAGAGAAAC
TCGATGTGACCTTGTCAGATGAAAGGTGGTTATGCCACACAGACTCCACGCTCGATTGCAGCACGTCCTCGCGATCACAGATGACGCTGAGTTTGGGAAA
AACAGCAAGGGGATCGCCATCCTGGGAGTCTTGATTAGATCTACTGCACATTTCCACTGCGAGGAGAAGTGTCTTGCACATTGGGTCCAACATGAAGTAG
AGTCGCTCGACAGGCAACCCCATCGCCGCTAGAACGCTGCTCACCGGGTGCCAATTGTCGCTGAGTTCTTCTCGGGGCTGGTTAACCAAGTACGGGTAGA
ATACCTTCACCAGCGAACTAAGTTCAGCAGAGACCGCCGGTCGGTTCTTCAGCTGTGTCAAGGCATCATTATTGGAAGTGCGTAGGAAAATAGACAACGT
CGTAGCAACCTTGAGATGTTCCCAAGTGGAGGCATGGTACTCTTGACGCACAGTCTCCGTGACCTCAAGGACCTCCCCGACTTCGATTTCAGACACAAAC
GGACTTTTGCCCCGAAGCAAGCATTGTATGTTGTCCGCGACGATTGAGCATACATCGTCTTGTACACCGTGGCACTCGTCAAGCAGATGCGATGCTAGGT
CAAGCTCCTGCGCCACCTCGCTGCAGAGAAGGCTCACGAGAGGTGGCTCTGGAACAGCAAGCCCGTACTGTTCCAGCACAAACATTATAGATCCCTCCAT
GCACTCGCCAATCGACGAGTGTCGCCGAAGGGCCTCGGTTAATGCTCGTGTGCTGCGCCACGCCAGGCATGCCTGCGCATCCACCTCAGTAGGCCGACTT
TCATCTTCCAGGAATGCCCatttcttgagctcgttaACCAGTCGTTTTGATATGGTCTGCGGATCGTCGGTCTCTGGAACAGGTTGCTCCTCCTCAGCAT
CTATCAAGCGCTTACCTAGTTGGATATCTATAATGGCAGGTACGTCGGtcactgttgttgctggcggcgcATCCGCTACCACGGCGTAGTCCGACACAGC
TACCGCGATATCAGCATCGAGGTCATTGTTGGCCACTCcctcttcaacttcttcttcgaagCTGTTGTCGTATTCGGAGCCGTTGGTATCTTCAGTTCGG
CTGGTTAATTGCTCTTCAGGCGGGGTAGATGGCTCAGTGGGTAATTTTTGAGAAGGATctacagcttcatcttgcacGCTCTCGTGCGGTGTGGCAGATT
TAATAGGATCAGCGCTGTCATTCTCGTCTGAATAGGTTACTTGCTGGAAGTCGGCTGTACTCTCGTGGTCCCCGTcc