Description :
From Genome Similarity Track
Location :
Scaffold_55:271768- 274651
Transcript NameFunction/comments
Phyin_T30-4PITG_17457Putative uncharacterized protein

Sequence
2883 bases(100 bases per row)
CTGTGCTCATCAATCGTCAATTTCGCGCCTGGCACAGCCGCAAGCTCTGCAATCAGATGCTGCTTCAACGTCGACAACAAAATAGCATCCTGCAGCAGTG
TCGAGTCCGACGTTCAGCGTCGCTGATATTGCGCGTGTTTCAAGCCTGGCACACGGAACTTATTGAGGTTCGATGTCGACGTGATTGGGCTTCACGGGTC
ATTCAGCGAAAATGTTGTTCAAAATTAGTCGTTCGTCAATACCATGTCGAGCTGCGACATCACCGGGCAGCGACCGCTACGATGAATCACTTGCTTTCTG
ATCGCAGACGAAAAATTCTGTTAAGCTTTTGGCGGGCACTCGCAAACCACGCGCTCGTCCGTCGTCTGCGCAAACGAGGTGCAGCTGTGACCATCCAAAA
GCACATGAGAGGTGTACTCGCTCGAAAGCAAGCGAAACGGCTTCGAGCCCGTCGTCGACGAGCTCTCAAGGTACTAGTGAAGCTTTCATGCTCACGCCAA
ATTCAGCTTCTGCAGACAGGATTCAACTTTCTTTGTCAGCACGTTCAGGCATACCACAGAAGAAGATATGGCGCGGTATTATGCATCCAGGGATTAGCTC
GGGGATTTGGCACTCGTCAAAGGCTGCATCGACGCCGTATTGCAGAAAGACTCGTCAACGGGGCCGTGACTATTGGCAGTAAGCTTAAGGGTCAATCCAG
GGACATTAAACTGTGGGCATGTCTGCTAGAGCTCTCACGGTGCATATCACTCCGCCATGCTGCTGTAATTCAGGTGCAACGGTGGTGGAGAAGTCGACGA
ACGCGCTCTCGTACACTTCGAGTACTTAAAAAGCGTGCAGTGCAAATACAACTACTTGGCAGATTGCAGAAGAGTTTCTACACCCTTGCACGAAGCATTT
TCCAACAACTTCGTGCAGAATCGAATGCCAGAAAGGCCCACCAACGCGCAGCAGCAAACATAATACAACGCCGACTCCGATGCTGGTTGATGCGTCGACG
GTACCTCAGCACGCTTGACAGACAGTCGATAGCTGCTCAACGTGGCAAAAAAGCTTCTAAGAAAATAGTATTCCAAAGAGTGCGTCGATTGTTTTATGGC
TGGAAAGAAGCGACGCGAGCGACACAAAGAGAGCAGTACGAAGCAGCTTGTCTAGTACAGCGAATATTCCGTCACCAACGTGCACAGCACCAAGCACGCT
GTAACATGGTAAAAAAGGCAGCTCAAGAGCGATTGGTGGCTACAGCCTCACAAAAGCCATTGGAGCGCTTCTTCCGTCAGTGGGAGGCCGCGGCCCTACT
TGATAAGAGTGTGCTGCATGTACGCAGTTCACCGTTTATAAAGTCAACGCCCGTGAGCGAGCAGTGGAAGCCTGGTACTGCGTCTGGAAACAAGTTTGAC
AAGCCCCTCACGCTCGAGGAGGTAAGCTGCCGCCGGCAACGCGTCATACTAGTAAAATGCACTACTAATCTCTCGACGTTCTTGAGCCCAGCGTGCAGAG
ATACCATCAATGCTTTTCTACATATTTCTCAATCGTGTTCGCCAAACTGGGATATGCCAGCTTTCGTATAGGTAAGTTCATACAACATTGTGATCTTCCA
CACGCCGCGAATGTCAAGTGAATAACCAGTTTCCTTGTTTCCCAATTATTCCACCCAGCGGGGGCACAGTATTCAAGAGTCCGCAAATCCGACAACTCAT
TTCTCTATCCACTAGCGTTATTGCCGACGGTGGTGGCGGCCTCCATACCAATTCAACCTCCAGTAAACCACTACTCAATCTCAACGAGCAGGTCGTGGAC
GCTTTGGACGCGTGCTCCAGCTCCCTTTCCAACTCGTGCCCTGTGCGGTCCCTCATCCTGTGCAACGCGCCGCTCCGATTTTTCCATGCGTCTCTTTTAG
CAGCCATAGTGCAACGCAGCCGCCGCAGTTTCAACCTCGCGCTGGTGTCCGTCGTGCTTGTCAACGTCCCGCTCGCTCCTGTGTCCGTCGTGTCCCTCGC
CTGTGCATTAGCTCAGAATCCGAGCTGTTTGCAGCAACTTGTTCTAGAACGTTGCCAAGTGGGCAGTGCTGGTGCCGCCGCGCTATTCGAGTCCTTGAGT
TACAATCGAGCGCTGTGGAAGCTCGACCTCAGCGGGAATCACATCGCGGATGCTGCCTGTCCTGCTCTTTCTCGAGCGCTGTTGGCCAGCAGCCAATTGC
GTGTTTTGGCGCTGAGCCGCAACTTCCTGTCGGACCGCGGCGTGTTCTGCTATCTGGCCCCGGCACTGGCCTCGAGTCAATTGGAGACGCTAGTGCTGTT
ACAGAACCCGCGCGTGTCGTCGATGGGCATCGGAGCACTTCGCCAAGCAGCGTCAACACGCGTGGTTTCAGATTGAGCTCTGTGATTGGTGGATAAATTG
CCAAGAAGCAAATACCGTACTGTCTAGGTCTTTACTTGATCTACACTCAGAGTCGTATATTTCCCACCTACTACAAAGAACAAGGAACCAAGTTTACTTT
TCACTGATTACCGCTCGTTACCGTTCTACAACTACAACCCGCTCTTCGCTCGCCCCACGCAAGGCCCCGCTCTACAAACAGCCGCGGACTGCCCGACCCT
GACCAGTAGCGCGGCCGGAGGCGCCGCGCGAAGGGGAGGTGTGCGACATTTGTATCTGACATAGCCTTGGCAATGACGAATCCCGTAAACGAGCCCTGAA
ATAGGAGAAACGCAGTGTTGCCCCTGCGAGACTTCGGTAGTGGGATGACAAAGTCCATAGATACGATCTGGAACGGTCGTTCGGCTAGTACGTTGCCAGG
TGAGTAACCACGAAGCTGCGGACGGCTTTTACTCGAGCTACATCCGGACATGACTTCACATGCTTTTCCACGTTAGCGTACAG