Description :
From Genome Similarity Track
Location :
Scaffold_1:2717310- 2718995
Transcript NameFunction/comments
Phyin_T30-4PITG_00513Myb-like DNA-binding protein%2C putative

Sequence
1685 bases(100 bases per row)
GCATAGCGATGAAGAAGTCGTGGTGGTGCCTAGACTTCCGAGAGTCTAAGCTGTCATTTTTGCTCATAAAAACAGCAACAGGAATGATTTTTGCCGGCGC
TACAGTTAACTTGTTTTATGTAAGTCCCAAAGACGAGCCAACAGCGGAGCTCGCCCAAACCTGCACTTTTGACTTGCCCCAAAATAATAATCAAAGCCCG
GCGGTGCACACGCAATTTGGCTGCAAACAGCAAGCATTTGATCGCTTTGTGGCACGGGCTTCGGTTATGGCAGCCGCTGCCCACGTTGGGCACGGCATGG
CGCATGAACGCTCACGGTAGGCGTCGTGATGGCGGAGGACGGGATGCTCGCTAGCTCATAATTCGCATTAAAAGCAAATTTAGAATCAAGAACTGATCTC
AAATACCTAAAGCAGTGTCGTAGGGCCAAGTTGGCAGTACCTGTACTGTACGGGCCAAGTTGGCAGTACCTGTACTGTACGCCGGCGATCGTTCAAGGTC
GGCGTGTCCGTCCTCCCTCACTTCGCTGCTGGCCACCGCCGGACTTCTGCACGTGTGGCAACGCGGCAATTACCCTCTCTTAAGTGCGAATGTCGGTAGG
TCACAGAGCCGAGCCCGATCGGGAATGTTTACTGACCAGAGAGCTTCTACCGCCATTGATTGGACGTGCCGACCTCCATCGTGGTTTACCGGATCGGCGC
GCTGTCATTCTCAAATTTGCATCACATCGAGCGAGTCGGGCAGACCAAGTGTCCAAGCTCATACGTCACTGACCACTATTACTCCAGCTACCGCTGCGAC
ACTGTTTCAATTTTATCATGCCCATGGTTGCTGCCGCCGGATCAAGCTCGCCGCTATCGGCTTCCAAACCTAAGGCCAAGTCCATTTCGCCAACGGCCAA
AGGTATCTGGTCTTTGGAGGAGCATGACCGCTTCCTGGAGGCCATGAAGCTCTTCCCTAAGGGTCCTTGGAAGTCAATTGCCGACCACATTGCTACGCGC
TCTGTGCGTCAGGTGCAGACCCACGCACAAAAATATCAGGAGAAGGTGTCGCGTCGATTGCGCGGCCTGCGAAAGTCGAAAAAGAAACTCGTGCGTCCTG
AGCATCGTATTGACGAGGACACTATGGAACTGTGCAAGCTTGTGGATTGCGCCGCCGGGAAATTGGTTGCAGCAAGCAAGAAGTCGACATTGCGAGTCAG
CGTCGTCGTGCTTGAGCCGTTGCAAAAGAAAAACATCTTGAAGGAGGAGCCCGTTGAACCTCACAGTAGCCCACGGGGCACGGATGTAGATATGAAGACC
GATGACTTCTTGCCGTTGCCATTCCTGGACTTTGGTGAGGATATCGACCTGGATCCAGTCCACATCCCCACCGTCAGCGAGTCTCTAGACTTCTTGATCG
ACTACCTGTCGATATAATCTCTGCAGCCAGCCACAGCTCGGTTGCTGATAGTGCAGTAGCAGGAAAGACCCGTCATATTTGGTGAGGTATCCTTGGTCAA
GCACACTTGCTTGATTCATATTTATATCATAAAGAGCCTTAGCAATACCACACACACACCTTATCCGTGGGGGATGATGCGTCGATACAACAGCTCGGAC
GGAGGGCGTACTGAATCCGAGTTAGTTCAGGCTCAACAGTCCCCGCTTGATCTCTGGACAACAATGTTTTCTAGGGTGTCATTTG