Description :
From Genome Similarity Track
Location :
Scaffold_94:2717- 3939
Transcript NameFunction/comments
Physo_121619reverse transcriptase

Sequence
1222 bases(100 bases per row)
CTTCAGCTGGCGAGATTCGAACGCCACCACGCGCTCGCGCCCGTCGGCGTCTGCTTGCAGCAGGGCACAGCCGATGGCAAAGTCCGAGGCGTCATAGACG
ACACTAAACGGACGAGCGGGGTCTGGCAAAGCCAGAATAGGCGCATGAAGGAGACTGTCCTTAATTGCCGCAAACGCATCTTGATGCTCGGTGTCCCAAC
ACCACTCCGCATCCTTCTTTAGGAGATTGGAGAGTGGCCGAGCCATCTCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAATTGGCCAAGCCAAGCCACTT
GCGAAGATCCTTCTGGTTCTTGGGAACCGGCCAGTCAACAATGACCTTGACCTTGACCGGGTCGGCCCTCTGGCCACGCTTCCCGATGAAGCACCCTAAG
AAGGGGATCTCTTCCGCTCCGAAGATGCATTTGTCAATGTTGGCGTACAACTTGTTTTAACGCATGCATTCGAGCACAGCACGCAGGTGCTCCGCATGGT
TCTCCATATCAGTCTTTCCGTGCTCCGCACGACTGTGGACAAAGATGTCATCGAAGTACGTTTGCGCGTACGCCCGATGGGGCCTGAAGAGCTGCGTCAC
AAGACGATTAAACGTCGCGGGTGGGGTCGAAAGCCCTTGGGGCATCACCAACCACTCCCAGAGCATGCCGCTCGGAGTACTCACCGCAGGGAGAGGAATG
TCGCTCGTCCTCATGAGCAATTGGTAATATCCATCAACCAAGTCGAGCGCACTGTACATCGTACATCCTGTCATGTTGTTCTGAAGAACATCCTTCCGAG
GAATCGGCGTCTGCGTCGGAATGGTAGCGGTATTCAGCTTGTTGAAAGCATGCACGATACGCCACTTGCCATTCGGCTTTGACACAGAACGTCGGCGTAG
AGTGTGGAGACTTACTCTCACGCACCATGCCCGCCTCATGCTTCGCACGGAAGAACGCGTCAATGACGTCACACTGTAGGGCCACTGCCTCGTCACGCAG
TACTTCGTTCCCGGAACGAGATCGATTTCGTGTCGAATACCTCGATCCGGAGGTAGCCCCGAGGGCGGCTCCTTCGAGACCACGTCCTGGTAATCCTTTA
CCACTTGATACAGGGGATCCGACGGGTCCTTCAGGATCGCCGATCCGCTCCGCGCATTCAGCGCCTTCTTGATGTCTTCCAGGATAGCTTCATCCAGAAG
CGAGGACGAGTTCAACTCTTCT