Description :
From Genome Similarity Track
Location :
scaffold_22:27168- 28255
Transcript NameFunction/comments
g1176.t1 hypothetical protein PHYSODRAFT_495612

Sequence
1087 bases(100 bases per row)
ACTAGGGAAAGCATAGACGCGGAGGCTTCATATCTCCACCAACCGTAAGCTCGCTTCGCACGGGATTACCGCCAGACCAATTCGACATAGACGTTGAAAT
CCTGCAGCCTTTCAAGGTCACTACGGACCATGAACCGGTGCAAGTGTGGAGTCTTAAAGAGCTCCTTCTACATGTATGTACATGTATAAATGTTCTCTTG
CTCATTCTTGATGGCACCACCGATCTTTTGCCTGTGCGGCTCATCCCCCTTAAAATGCGACGCGGCAGTTCGACTGTCGCGTTTTCTGAAGTTTGGGCCA
ACAGTTAAATGCATCCAAAGAGAAGAGCTGCACATTATGTGGAGGCTTCGAAATCAGATGATCGTTGATACTCTCAACGACCAACTGAGCCGCATCCTTT
AGCAGCACGGCGTGTACATACAGGTAACTGTATTCTTGCTGTAAGACGAGGCTGCGTCACCAACGACACATTGCAGATTGGCAAGTTGTGATGTTCAACC
GCTCTCACGCGTTGTTCCAAAATACCATAGGTACTTCATATTTCCGCTATGTACTCACTCACAAAACATGGTATGTTATATTTTGGTAGAGCTCCAAAGC
GAGCCTGCTATCACTATGGTATACTAATTTCACCAGGCCTAATTGGTGTTGTTGCGGACGTAGTACGGCTCGTTCTGGAACTCCACGTCGCAGTACGGGA
AGGCGGTGTCATCGTCCGAGGGGGAGAAGAGTTCCTTGGCGGCGTGAATCATCACGTAGAAGCCCGCACAGCCACACACCAGCATCACCAGCATCGACAC
GCCCTTGTCAAGCACCGACATCTTACGCCAGAAGATACGCAGGTAGATGAGGAGCGGCATGATCATACAGTTGACGGTGTGGGCCGTGGCGCCGGTGAAG
TCCTCCAAGTCAAGGAACTTGTTCTGTGCAGCCACGGCGATGATAACCAAGACAACAATCACACTCAGACGTAGCGTGATGTATCGGAGTTTGTTCTTGG
CGCCTAAGTACGGAGCACGGAGCTGCTCCTCCGTGATCTCTTCGGGGAACTCGATCGCCGCGCGGATGTGCGAGATGCGGCCCTCCG