Description :
From Genome Similarity Track
Location :
Scaffold_2:27165- 28208
Transcript NameFunction/comments
Physo_487961chemotaxis protein CheY

Sequence
1043 bases(100 bases per row)
ACGGACCCCAACGGGAGCGGCGTCGAGAGAGCACCCGGAGGCCGTGGTGGTCGCGGGGCAGGTCGCGGTAGTCGTGGAGGACGAGGAGATTCGACCAGGC
CAGCTGCATCATGGAGCGATGATGATGTGAGCGAGTTCTTTCGCCTCCGTTACGCAGAGTTAGCTGACAACTTCAAGAACCCGAAGGACACCAAGCGCAT
CAAATATGCGTGGGCCGTCTTAGCATCAACACTCTCTGTTAACCAGAGCAAAGTGTTCACTGACCAGCAGTGTCAATCTAAGGTAAATATCTACAATGTG
AAAATATATATCGGAATGAGCCACTACTAAGTTATTAATCATGATGTGCGGTGAATATTTTTTAAAGATGAAGAACATGAAGCAAAAGTGGGCGACTGCG
CGGGAAGCAGAAGGTCGAACTGGCAACGACGGACCCGTGCGGCGCCCAAATCACTACTCCATCATGAAAGACTACTGGGGTGATGCGACGCGGATGAACA
ACCGACCGCATATTAGCACGGAGGACCCGGATACAACTGCTGCTGCTGGTGACGCTGCGAGCGCCGACGTCGCTGCCTTCGTCACGCCTGCCTCACCTCC
CCCTCCTCAATCTCCAACGCCCCGCACCATGTCTGGCTCCACGGGGTCGTCTAATAAGCGACAGAAGCGCACCCAGGGGGGGCGTGTGGAGGCGGGTTTG
AGTGCGGTTGCTAAAGGGTTTAGCGAAGGGCTAGAAGCTTTGGGCCAAGGACTTGCTACAGTCCGAAATGGGGGTGCCGAAGACATTGCAGCTGCTGTGC
AGCAACAGACCGGGCTGTTCCGCGAGCAAAGTGAGCGGGCTCATGCCCAAACCGAGCAACTCTTGTCGGAAATGCAAGCTCAGAGCGAGCGACTTCGAGT
GCAGAATGAAACGATTCGAGAGCTACTGGATTTGATCCGCCGCGACCATTAAAATCTAGCTACACACGTTTTCTAGACTAGCTCAAAAGCTTCGGTAAAA
GCCAAAATGGACTCACGTTTTCTCGAACCAACATCTCTTAGAA