Description :
From Genome Similarity Track
Location :
Scaffold_145:27158- 31360
Transcript NameFunction/comments
Physo_143597reverse transcriptase

Sequence
4202 bases(100 bases per row)
TCGTACAGGAGGTCACCGCACGAGAGATTGGACGCTGGTTCCCATGTCGGCTCGTCATAGCCGACCCACTTCACCTTGAACTTTCGGACGGCCCGGTGAG
TGCTCGTTGACAACGGTGTCCGGTCATCGAGGATAGCCTCGACTTCGTACTCGCCGTCCAGGCGGTCCGGCTCAAAACTGTCTTCAGGCAGTAATTCCTC
GTCGAAGTCAAGACGAGTGTCTTCGGTGACCTCACGAGCCAAACGAACCCTCGGTCGGCCTTCGAACTCATCCACTGACTTGAGTCGTGAAACATGCACC
ACCTGGTAGAACCGGTATCCACTTCGGTCGGGTAATTCCAACTCATACGCAAATTCGTCGACCTTCTTCTTCACGCGGAACGATCCGTGCCACCGATGGG
CTACAGTCCTGGTCGAACCCGCTCCATGTACATCCACACTCTGCTCCCGGGCTGCAAAGAAAACCTCGTTCTCGTCACTGCAGCTCTACTATGGTCAGGG
TAACTCGGTGCCCGGTCGACCGAGGTTCTATTCTCGTTGACGCCTGCCATAGCTTCCTTCTCCTTCCTGCCAAGCGACGCATTGTGCTCTTCAGCTGTCC
GAGCCTTTTCCGCGGCTTGGTTCTCCTTGGCCATCCTCAGGGCGATTTCCTGCTGTCGGTTGACCTCTCGGCGCCATCCTAGCGCGTCAGTTTGGCTACT
GAAGCCTCGTTTGGGTGACGAGGACATTGCCTTGAGCGTCGACTGTGCATCCCACCCATGAACGAGGTAAAACGGAGTTTCCTTCCTCGTCGTATCACGG
GAGTTATTGATGGTGAAGATCCGTCTTTCGGCGATCTCGTCCCAATCCTGCTGTAGTGGGTCTTCAGCGTATACGCGGACTGACTGCATGATAGTCTTCA
CCGATCTCTCCTGCTGGCCGTTGGCCTGCGGGCGGTAGCTCAGGGTCGCGTTCGACCGAGACTGCATCATTTCCGCGAAGGCTTGGAAGATCTCGCTCAT
AAATCGAGGATCTCGGTCACGACGGATCAAGGACGGTGCTCCAAAACGTCGGTAGACACACTCCTCAAAAGCTTGCGCAACGAGTAAGGCGGTAGCGTCA
GACATGGCTTTGCCCATCACGAATCCCGTGAACGAGCATTGGAATAACAGGAGAGCCGTGTTGCCACGGCGACTCTTCGGTAGCGGTATCACGAAGTCCA
TAGAGACTAGTTGGAAGGGTCTCTCGGCTAGGATGTTCCCTGGTGAGTACCCGCGGAACTGAGGTCGGCTCTTACTTGAACTGCAGTCAGGGCACGACTT
AACGTGTTTCTCCACATCGGCATACTGGCCGATCCAGTTATAGTCTCTCGCCGCTCGATGTAGCGTACGGGTAATACCTTGATGACCGCCTTCGAGTGAG
TCATGACAGCATTGCAGGACTTCTTCGATCATCGTTGTGGGCACCACGAGTCTCATCTTCAACTCGGCTTGCTCGTCGTCACTTGAACGACGGCTCGTTC
TTGTGTAATATAGCACATCGTCCTCGCTCAACACAAATTGGTCAGCCATTTCCCATGCATCTCGTGCTGCTCTGTATCCAATCTTCGCATCATCTCCCCG
GAGCACTGCCTTCAGATTCGACCACCGTAACTCTTCATCTTGAGCGGAGGCGATTCTCCTTCGGCGTTCTTCCTGTACTACCAGCGGGTCAATGTCTTCT
GCGTTCGGTGGGGCTGGTGACGTCTCGGCACGCAGCGGTGAAGCTTCTGCTTCATTCTGAGACTCGTTCGGCACACCATTGGCTTCTACTCGGTGAGATG
CGTCTCCCTGATCGGTGACCGAGACTTCATCTGCAAACCGGACGTGTTTCTCCTTTGCTCTTGTTTGACGTCTGGTCACCACAGCTACTTGTCCGGGTTC
AGTCTCGTTCTGCCGTCTGCGCTCGGTTTCTCTTCGCTCAAAATCGAAAAAATTTTTGCTACGAGGTTTGGCAGAAGCTACCACGGCCCATACTGTGTTG
GCCGATGGTATGTCCTCGACGACGCAACCGTCAGCAGCCTCGTAGATGACTTCAGCGATACGGTTCAGCTTCATCAGCGCTAATACTCGGTCGTCCGACG
ATACCACCGTAGACTCCTTGCACTCGAGAGTCTCGCTTGCCAGAGAGTCGGCCGCAGCGTTAAACTCTCTCACCACATGCAGGTACTTCACTGACCGAAG
CTTGGCCGTGAGTTCTTGGTGGTGGCTGACTTGTTGCAGCAATGACTCCTTCCGACAGGCTATCACCCCTAGGGCTTGCTGGATCGCGAGCCTCGAGTCG
CCAACGACAACTAGATCGTCGGCTCCATGCTGTAATGCAGCAGAGACGCCGTTGTTCATCCCGGTGTACTCAGCGAGGTTGACCGTGGTGTTCTCGAGGT
AAGCGCTCGCAGCAAGCACTACTGTCCACTCTGGTAGCTTCCATAGTATCCACGAGCAACTGCCGTATCCACCGTTCTTCTCGGTCTTCGCAGACCCGTC
AAACGACATAACGAAGCCTCGGTAGGACCGCGGTAGGCGTGCGTAGAGCAGATGCGGGTCCAAACGAGCAGTTGGTGGCCCTCGTGTCCGGGGTGTGACC
AACGCCAGTGACTTATCCAAGTCAACGAAGTTCGTCAAGCCGGCTTGAAGTAGCTGTGCAAACGAACAGTCGGTTTCTTTGACTCGTTCGACCAACAGGT
GCCACGGCGACAGCAAGACGGCGAACTGGGTAGCTCGACCGAACAATGTCTTGGACTTGTGGACCCAGTCGAGTGTCGAAAACCGAGTGTAGACCCGGCT
TCGCTGTCCAACGAGTTGAGTATAACACACCTTCAGTATCAGCAGAAGCGCGAGGACCTCTTTCTCGGCCGGGTGATAATTCATCTCAGCATCCTTCAAA
ACACGTCCGCAGAAGCGAACGGGGTGTAGTTTGCCCTCGTGCTCTTGCATCAACGTGGAACTTAGAGCCCACTCGTTGGCGAACAACATGACATGCACTT
CCTTCTTCAGGTCGAAGTGTCGTAGTATCGGTGCTGACGAAACCTTCTGTTGGAGTATCGCGAAGCTGGCTTGGCCGCGGTGAAGTCACCCCCGGGCTGG
AAATCCTCGTCCTTAAGCTGGTACAGCGCTGCTCCATAGACCGCGAAGTCTTGGATGAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGGACTGCATTC
CTTTCCTCGTTGACGGGAACGGAAGCTCGGCCACCCCAGCCAGCTTCTTAGCATCCGGTCGGATACCTTCTGCCGAGACTTCGTGGGACAGGAAGTCTAC
CTTGGACTGCACAAAAATGCTCTTCGTGAAGCTGATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCGGTCTAGCGTCGCCAAGCACGACTCGAAA
GTCTCGGTACCGAAACAGATATCATCCACGAATGACCGGTGACTGAATACTGGTGTCGACGAGGAGTCATCGGGCTCCCCGTTGGCGAACATGTCGGCGA
TAGGGCTGTTGACCAGTTCGGCTATAGCTCCCTTACCAAGCGAGTTGTCTCGGTCGGCCTCGAACTTGGTCCGGAATGGCTTTGCCGTGCCAGTCGAAGC
CTCGTTCGCCCCAGCATGAGCTTCCTTGTCATGTTCTTCAGCTAGACGCATGCGCTCCGAGAATTTAAACCATCCTCCCGTCGGTTGGATGAAGCCCCAG
AGCGCGTTGTCAATCATGCGTTGACAGATCATCGGTGCGTTCTTCAGGCCGAAAGGCATACGCAACCATTCGAAGTGCCCCAGTGCGCAGACGAAAGCAG
AGATCTTCCGAGCTCGTTCGGTCATCATAATGGCCCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAACCACAAGTACGCCTCCATGTCCGTCAGCAAGTC
ATCCACCAGGGGCATGGCATACTCCATAATCTCGGTGATCGCATTAACGAGTTTGTAGTTGATACACAGGCGGATATCCACCCCATTCTTCTTCAGGACA
ATGACGATTGGCGACGCCCATGGGCTGTCCGAGAAGGAGATAAGCCCGGCCTTCAGCAGACCCTTCAGCAATTCGTACAGCTTACCGAGGAAGCGAAGCG
GGGTCCGCCGAGCCTTCTGCTTGATTGGCGCGTGCCCCTGTACATTGATGTCACACACGACCACGTAGGCTGGAGGCGGCAGGGCGTTACCGCTCCCAAT
CA