Description :
From Genome Similarity Track
Location :
Scaffold_105:27152- 29260
Transcript NameFunction/comments
Phymu_g4415hypothetical protein PHYSODRAFT_255250
Phymu_g4416hypothetical protein PHYSODRAFT_308430

Sequence
2108 bases(100 bases per row)
CTCAGTATTATCTGCTGGATTGCCATGAGCTACACGCGCGATATGGGCGAAGCTCTAGGAGACCACGGAGACGGCACCGACGGGCAACCAACCGACCGCA
CGTGGACGTCGACTCTAACTGTGTTCTTCTATCTGTGGATGGATATCACCGTTAATGTCGTACAGACTCCAGCGAtgcttctcgttgctgaCTTTGCCGG
TGATCGGCAGacaactggagctgctctcggTCAAGCTTGGTCGACGCTGGGCTCGATCCTCGTGGCTGGTTACATCGAGTTCTTCGGTGCCGCCCACAAG
ACCCTCCACGAGTTCATGTGGATGTTGTCGGGTACGATGTTCATCTGCATCACTGTCGCTGTGGTGTTTGCTAAAGAAACCCCACTGGATCCTAGCAAGG
TTGACGCTGTTTCGACCTGGCAGCGTATCGGTCACGCCTTTGCTTCGGTTTACCACGGCATTCGTACGCTTCCCGGTGTGCTCGCGATCTACGGCGTCTG
CTTCTTTTTCGTCCAGTACGGCTACACGGCGTACAATGGCAACAAGGGGCAGTTCTTCGGCCTGGAAGTGTACAACGGCTCGGCTGAGAACGCCGACAGC
TGCAACCCGTGCACACCCGAGCAGGACGCCTTCAACCACGGCGTCAGTATCGCTGGTGGCCGCGCTGACCTACTATTCAACATTGTTGGGTACATTTACT
CCTGGACGCTGCCGTTCCTCGTGCACAAGTTCGGGGTCAAGTGGGTTCTGACGCTCTCGACCATCCCGCAGATGTTCCTCATGGTCATGGCGTGGACCAG
CAGCGTGTCTTTCAACGTGTTCGTGGTGGCAATTACTAGTATCACTCAGGCGGTGTGGTTCGCCCTCATCGTGCCGGTTATCATCCACGTCTTCGGCGAA
GATGAGGAAATTGGTATCTACGTTGGAGCTCTCAACTCGGCGAACTGCTTCGGGCAGCTGCTGAACTTCGCAATTGGCTCTGGACTGGTGGAGACTTCTC
TGGGCTACAAGCTCCCGGTGTTCCTTGGTGGTGTCATGAGCGCTCTGGGCTTTATGACGGCTCTTCTTTTCTTCAAGATGAAAATGTACTCGATGTAGGC
TAGGCTCGTCGATATATAAAACGGCAAAcgtatttttcttctttagTGATATTTTCTTAACCTATCGGATATTTACAACGTGTGCATCTTGACTTTGAAG
ACGAACAGAGTGAAGACCATACCGATGAAACTCATGAGGCCACCGAGGAACACAGGCAGTTTGTAGCCCATGGAGGTGTCAACAACACCTGCCCCGATAA
TAAAGTTGAGGAGCTGACCGAGGCAATTTGCCGCATTGAAAACACCGACGTAGACGCCGATATCGGCATCGTGTCCCAGTACGTGGACAATCACCGGCAC
ATTCAGTGCAAAGAGGGTCGTGATGGTGATTGAGGTGAAGATGATAATTACCACGTCAAGTGGCACATTAGTGGAGAAAGCCACGACGATCAGCAGCGAC
TGGGGAAGTAACGAGACCGCAAGCATCCACTTGGCACCGAACTTCTTCACAAGCCACGGTAAACCCCACGAGTAAATGTAGCCCACTATGCTGAACAGGA
GATCTGTGGTCcctccagcaactcggaCGCCACGGTTGTACTCATCTTGAGCTTCCGTGCAGCCAGGAGCACAGGTCTTGGCCCCCATGGCATTTCCTCC
GTACACTTCGATACCGAAGAACTGCCCTTTGTTGCCGTTGTAGGCGGAGTACCCGTACATGACACAAAAGATCACGAAGCAAtacttgagcagctcaaat
GGAAGCGACTTGAACCCGTCGTAGATGGATTCAAAAGCGTTCTTCACTTGCAACCAGGTGGACTctgtgagctgctccagcttctctcGCTGTCTCTCTT
GACTGAAGAAACACGCGACCGAAACGGTGCCGACCATCACGGCCGACAGCATAAAGAGGAACCAACGCAGAGTCAAATGAGCTGCTCCAAACAAGTAAAT
GTAGCCGGAGACCATAACGGCCCCCAACAAGGACCAGCCCTGGCCGAGACAAGACGCGAGTGTTTGCCGTTCACCTGCAAAGTCGGAGACCATGAGGtac
agcggcgt