Description :
From Genome Similarity Track
Location :
Scaffold_601:2715- 5331
Sequence
2616 bases(100 bases per row)
TATGTGATCTCTTGTGGATCAACATATCGCTTTAAACGACCCACGTAAAATACGGGGTGTGTTTTCATGTATGATGGGAGAGAGAGTCTATAATTTAGGT
CTCCGACTTCCTCTGCCACAGTAAAAGGACCGATAAATCGTGGCAATATTTTGGTAGTCCACCAGGTAATACTGAAACTGCATGTTTAGGTAGAGTATCA
GTACTTAATAGTACTTTGTCTCCTACTCTAAAGTGGTCATTTTTGCGACCGATTCGGTCTGCATATTGTTTTTGTTTGTCCTGTGTGCTTGCCATAGCGT
CACGGACCTTACGTGTGATGTTAATCGCTCATCCACAAAGCGTTGAGATTCTCTAATGCTCTTTGCATCCAGATCTCCAATGAAACTACCAAAAGCTTGG
TCATGGGTCGTTGCTACTAATAATGATCTACCGTCATTTCTTTGGAGCACAGACAACGTGTGTCGTGACTCCGACTTGACACTCTCTTGTGTCATGACCA
CTGCAACACTGGCAGGGTCACTAGAGCGAGTTTCTACCGTAGCATTAGCGAACCTATTACGCTCTTCCGCATTTTCTCCGAGCGTAGTGAGGGGCTCTCC
CCCACTAAGACTCGGGCTGCGCACAAACGAGACTGGCGTCCGACGATGGAGCAGTCCGTTAATATAGAATGGTGCTTAACTCGTACTGGCGTGAACACTG
TTGTTAATAACAAACTCCACGAATGGCAAATGTTTGCTCCATCCCGTGGGAGTTGCTATTGTGCGCAATACATCCGCCCCAACACGATTGATCCTTTTGG
TCTGACCATCGGTTTGGGGATGATCGGCGGTAGCCATGTAAATCTTCTTACCAAGCAGCTCAAACACATGGCGCCAAAACCATGACGTAAAACGTGGATC
CCGGTCCAAAACTATGGACTCGCGCATCCCGTGTAGTCGATACACGTGATCCAGGAACAAGAAAACTGCCTCCTTGCCTGAGATCTTGGTGCTTCAGGTG
TTAAATGCACCATTTTGCTCAGTCTGTCAACAAAGACGACGAGATCAGTCCTGCCTTTAAGGTCAGGCGGCATTATAAACATGAAGTCCAAACTGACCGA
CTTCCAACAATCAGTTGGTATTGGTAGTGGCTTCAGTGGTGCACTACTAGAAGGTGCAGGCTTTACGTGCTAACACGATTCGCATGATCGACTATAATTG
GCTACCCATCTATATAGGTTCGGCCACCAAAATCCATCTGACACTCGTAAGAATGTCTTCTCACGGCCCAGATGACCACTTAATAGTGCATCATGGAGCT
CGTAGAGAATCTTCTGTTTGAGATCTGTGTCATGGGGGCGATAGATTCTCAATGGACCACAAGGTGATAGTTGATGCCATAACAGGCCATCACTATAACT
AAAGCGGTTAAGCTTCGCCTTGAGGTGCGACAGAAGAGTAACTTTTCGTCCACCAAATTGACCTATAAGCAGACGACAATGTTCGTCCTACATGTAGCTC
TCCTTTATGTCAGAGTCCAGAGTTTTTTGCACATGGTCAAACCGTAGGGCTGCCAGTGGTGACGACTCAATTCGTGCTTTAGCACGAGACACGTCTTCAA
GGTGTCGAACCTCGAAGTCTGGTCTGCACGACTACGCGTCAGCCAAGACATATGACTTCCCCGGCTTGTATTCAGCTCGAAAATTAAATTCTGAGAAGAA
TGTGAGCCACATCTCCATCCTAGGTGATAGGTGCGGAGAGTTTATCGCGGTCCGCAGTGATGCACGATCCGTGTAAACTACAAAAGGTTCGGTGCCCAAT
AGGTGCACTCGAAACTTAACAAGACATACTTTATAGAAAGTAGCTCGTTGTCTTGCACGGAGTAATTCAGCTCTGCGGCCTTGAAAAGTCGGGACTGATA
CGAGATGACACGGTCAGTACCGTTGTCATCCTTTTGCACAAGTGCACTGACGATAGCGAAATAACTCACATCGCAGACAACACAAAAGGGCTTATCCGTG
TCTGGCAAAGCCAAGACCGGTGCCTCTACAAGTGACTGCTTCACTAAAGTGAAAGCATCTACATGAGCCTCAGACCAAGTCAACTCTGCGTCCTTTTTCA
GGAGGTCAGACATTATTTGGTTTGCTCTGCATAATTCTTGCTATATTTGTGCAAGTAATTAGCAAGCCCAAGGAATTGACGCAGCTCTTTCACATATTGT
GGGACTGGCCATTACTTAATAGCTCTAACCTTCTCTGGGTCTGCTCTAACACCGTGTTTACCCACGATGCAGCCCAGTACAGGTATTTCGGGGACCCCTA
TGACGCACTTTTGCAAGTTGACGTGCAATTGGGCATTGCCCAGAGTCTGCAACACAATGTTCAAATGAGGTTTGTGCTATTCTATCGCACTCAATCTGTC
CTCGGCCCTACTATGAACGAATAAATCGTTACAGTAATGAGACGCGTAGGTACGGTGTGGACGCATCACATGAGAGACCACCCGATTGAATGTCGCTGGT
GCGTTTTTCAACCCTTGCGGCGTCACTAGCCACTCCTACAGCATACCGATTGGGGTGATAACTGCCGTCTTGGCTACATCGGTCTCATTCATGAGTACCC
GATAGTAGCCATCCTT