Description :
From Genome Similarity Track
Location :
Scaffold_1997:2715- 4078
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1997-abinit-gene-0.2Callose synthase

Sequence
1363 bases(100 bases per row)
CCAGCATTTTTGACTGCTGGCAAATTGGATGAGTCGCTCGATATTATCACCGAGTGCGCCGCAGTTTACGAGAAGCTGAGCTCTGACAAGAAGAAAAAAG
ATAAGACTCTGCAGAAGGTTGAAAACACGATGCGGGAGCGTCTGTTGAAGGATGATTTGCGAGTCGAGTCTATCGTTGGCTCGTACAAGTTTTCATCCCA
GGTTGTCCGGTTCCTTCTTGGTGACGAACACAAGGACTTGGGTGCGTGCTTCGACTTCATGGAGGAAATGGTTACCCAGCAATCCGTTCTGAAGGGTTTG
AACTTGAAGAACTTGCATCAATGTCGCGCTGCTACAGCTGAGCTGATGAAGGCTCTTTTGGAAGTCCCGAAAGGCTCGGGAGACAACAGCATCAAATTTC
AGCGAGCGTTATACCGTGTCATCGATTGTGTTGAAGCTGTGCTAAACTGCATGAAGAAGGTTCTCGGAAAGCAAGAAGATTTGCTTCAAATCCTGAACGA
CACTCCATTGAAGCAAAACTCGTTTTTCTTCCCTGGTGGAGCACAGACGTACGCGAATGTGCAGCTGCAAAAACTAGTCAACTCGGACACTGCACTCGAT
ATTGTGTCTCGTGCATACCAGTTGCTTACGGTGGACAACTTTGACGCTGAACCACGATCTGAAGAAGGTCGACGCCGTTTGCGTTTCTTCGCCAACTCTT
TGTTCATGGATATGCCAGATGCGAGATCTATTCGCAAGATCAAGTCCTTGACCGTGGCAACTCCCTACTACAGTGAAATTGTGATGTACTCGATTAAAGA
GCTGACTGCCCAAAATGAAGATAGCATCAAGCAGCTGTACTATTTGAAAACAATCTACCCATTCGAGTGGGAGAATTTCCTGGAACGCATTCAAGCGAAG
GACATGGAAGAGGCTCTCAAGAAACACCCAGAGGAAATCCAGCTGTGGGCAAGTTACCGTGGTCAAACCTTGGCTCGTACTGTGCGAGGCATGATGTACA
ACGAAGACGCCATTCGTTTCCTTCACTGGTTGGAAATTTGCGAAAACGAAGTGATGCATCAGTACGGCTGCCCATGCAACAAGTGCAAACGTTTGGATGA
GATGGTTGCGCTCAAGTTCAACTACATTTGCACGTGCCAAATTTACGGTAAGCAAAAGGCTGAGCAGCGCCAGCAAGCCCAAGATCTTGAATATTTGCTT
AAGAAGCATCCAAGTCTTCGCGTTGCGTATGTCGATGGCCCAAAGAAGATGAAAGAAGGTCCGCCGAAGTACTACTCGGTTTTGATTCGTGCTCAAGGTG
ACACCATCGCTGAAGTGTACCGTGTCGAGCTTCCAGGTGACCCGATCATTGGTGAAGGTAAGC