Description :
From Genome Similarity Track
Location :
contig_66:27131- 28401
Transcript NameFunction/comments
g11274.t1hypothetical protein

Sequence
1270 bases(100 bases per row)
TTACCTTTTTACAGAGCTGTGTGGTGAGATTTGCTGCGTGCATTGGATGATTAGGTTCTGGGACATGCAAATGACTTTCTGACGCAACGCCCAATAACGC
TGTTGAAGGACACATTCGTTATCCGGGGGGATAAAGCGGTGGCGTATGGCTTCATTGAAAGCTTCCCAAGACTTGTTTCTACCCGCCGCACTCGATTGAA
AATTGGCGATACCAGTTCATAGTAACCACCTCTAATGGCATAAGATCATGATCAGGAATTGTGTCGATCCCTCCACCATATGTGGATGATAGTCAACGTA
GTATTGCTCGATAAATAAGATGCAGAGCTCTAAGTCCTCCGTGATTTTGCCTTCATACTATGTTTGGATGTTTGTTGTATGTCCATTGCACAAAGCAACA
ATATCATGCCGTCTAATGCTACAAGGAAGTCGAATATATGATGGCTAAGCTGATCGTTCTTCTGAGCGGTCGAACGCTCTGGAAATGTCGATCGGAATAT
TGCCATCAATCTCCCAAGTTGGCTCGGGCTAGCCAACCCACTTAACTCAGTATAAATATAGTGTGCTCTGATATATAGGTCCCACTATCTGAGGTGCTGT
ATGCAAAGAAGTTAGGTAGAACATCAAGTTGCCGATTCATGGATGTTCTGAGCTCTGTGATTGGTAGACTTCAGATTGTTGATCGTTGAACCAACGTGTA
TGGCGTATAATACGTCACAATATAATAAAGGAGGCTTAACCACGCGTTTGGTTGGGAGGCCTTCGGTCGAGGAAATCAATCACTTCTGGGTTTCCCCGCC
AGCCTCCAGCTACCTTCTCACCTTTTCTTCCGCCACCGCAATGTCAGCTTGATACAATATTACGTTTGAGTAAGATCAACTAGTTCACAGAGAAAAACAT
AATTGTGGGCCTTTTGTTACAAGAATTGGTAGATTTCCTCAAAGTATTAAAACAAGATTCAAATATTGAAATACAGCGAGAGCCAATGTTACAGGAATAT
TTAGCCTTAATATTTTGGACAAAAATTCAGGTTGAAGCAGTTAGCACCGTGAATCCCCTTTAGGTACGAATATCGCCTCGCGCATTATTGAGCACAAGTT
TACGGCAGCAGCATGCGCACGGAAGGCTCGAGCGCGCGCATCAAGAAGAAGAAGCGCTCGTCGGAACGCTCCAAGCGTCACGACAAGAGCGCGGACGAAG
GAGAATGGAAGCAGTTCACGTCCCCCGACGGCCACCCGTACTTCTACAACGCCGTGACCAAGGAGAGCAG