Description :
From Genome Similarity Track
Location :
Scaffold_67:271294- 277577
Sequence
6283 bases(100 bases per row)
TATCTACCTATAAATATACCCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTTTCTTTTGATAAAGAGGGGACCCGTGTACTGCCGTTCACGGAGAG
TTTGTATACTCTCGGAAGCTAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAACCCACGCCACCGCGGGTAGA
CTACCTGAACTTCTCCGAAGTGCGTTGCCATGGACAGGAGCGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTT
CGGGACGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGACCGAGCGGCTCGAGTGCGTCAATGCGTTTGACGCGTACGAGCAGGGCCTCATTGCGCAT
GTGCGGGAGAACCCGCAGGCTCCAGCGGCGGAAGCAAATCCGCCTCACCCGAACCAAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGA
ACCTTCACTTCTGGGTTCGAGAAGTAGAGCTCGCGATGGACGCGGGTCTGATCTCGACCGAGCAACTTCGTGTTGCTTCTGCACTCTCCGATCTTAGCGT
TCGTGCTAAGAGTTGGATGTACACACGGGAGGCAACATCTTCTGGATGTTTCACATGCTGGGCTCAGCTGTGTGAGCAGCTCCGATCCGCGTTCCTCCGG
GCGAACTACAAGTACCACCAGCGTTCGCGCTTCCTCTCGTGCAAACAAGGGAGGCGGGAACTGCACGAGTACGTGCAAGCGATACGGAAGCTCACGGCGT
CCCGAGTGGGAAACCAACACAACGAACACATCAAGATGATTGTGTTCATGGACGGCCTTCGAGTGGGCCCTGCACCCACTCATCTGCTCCGGGTGCAGTC
AAACACCCTTGAGGAGGCGACCCAAGTAGCTCTCCAAGAAGAGTACAGTGATTGCCAGGTGCGTACGCCGGCCTCAGCGTGGCCTGGGAGCCCCTTGTCG
ACTCCCGGTCGAACGAGCCCCAACGGACCTGTTCATATCGAACTCGGGTCCGCCGAACAGCGTGACGTCCGCTGCTTCGGCAGCGGGAAGATGGGTCACT
TCAAGCGCGACTATCCCGCGGAAAAACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCATGATCCCGGGGACAGGAGAA
CGCCGGGAATCAGTAGGGGCGGGGCGCCCCACTGGGGAAGAACTAAGTCTTCGCGATGGGTGCGCGGGTGGCGCGTACCATGGGGACTTAGCCCCTGAGA
GTCTTCGCACTTTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGGGTACGGGGATACGATCGTACTTTTAGAATCTCGATCGATTC
TGGGGCGGTGAAGAATTTCGCACGCCGCCAGACGGCTGCTCGTAATAGCAACAAGCTGTCCGATGCTTTCAGAGAAAGAAAGGACAACGGGACGATGTCA
GTGCGACTGGCCGACGAGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTATTC
TCGATATGGATTCATATGACATGATCTTGGACATGCCCTGGCTCGAAAAGCACGAGCCCTGGATCGACTGGAGAGGAAAGGCAATCGGTGCCAGCCGCCC
TGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCACCCGCAAGGGTTGCCAGGGAGCCAAAGCATCCGGCAGATGT
TTGGGAGTCGTCGACGTATATGACGACGCTGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAAGCGG
GTAACTTAGTTCCGCAGACAGCTGCAGCTGTCACGAACACTGACAATAATGTGTTCAAGGTGGGTAACAGAGCTTCCCACACGGCGCCCAGACCTTAACT
GAAGTGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACATAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAAGAAGGCGTCGAACACGCTTCCT
GTGTGGGTACCACAGTACCCCACGAGGCCACGAGTGCCTCGGATGTCGGAGCGCCGACATCCTTAGACGTGGGTAGCAGAGCTCCACGTCACGATCGCCG
TCGACGTCGACGCCGCCGCCGCCACAAGTCGGATCCGAGCTTCGTTTAGATCGACGTCGCTTCAAGCGACTCGGAGCCCAGGGCCCGCGCTCCTCCGACA
AGGCCGGTGGAAGAGCGTTTTCACATCTTCGATGGCGAGACCGGGTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGA
TACTGAGCCTCGAGGAAATGACGGTCGAGGCTTTCCTGGCCAACCTCAAGGCTGGAAAGGTCGCCGAGATGGTGCTCATGAGACCTGAGACCACTCAAGA
GGAGCTGAACTCCTCCTCTGTCTTGGGCAAGAACGTCCTGGAAGACCTGAATAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAACCCCAAG
GATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGTGTACGGCATGAGATTGATC
TCGTGTCTGGCACAAAGTACTGTGTCACGAGGCAATGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTTGCTGCGGAAGCGAAGGAAGG
CATGGTGCGGGAGTCAACATCCCCGCACTCGACGCCAACTTTCTGCGTTCGGAAGCCGAACGTCAAGTGGCGTCTAGCTTAAGCTTATAACAAGCTGAAC
AACGCAACAGTGCCGGCCCAAACACCGATCTCACGAAAGGAGATTGTTAAACAACATGCCGGTAGCGTACTGTACAGTGCGCTGGATTTGGTAGACCGAT
ACTTCCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGCAAGCACTCCAAGTGGCATGCTTTGTGAGCGGCTCGGCATGCCGCAGGGCTTGTC
TAACGCCCGGCGACGCTCAACCGCCTGGTGACGCAACTGTTCCGCCCTTTGCGTATCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTG
CCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTGGGGCACCTCCGTCGAGTGTTGGACGAAATGTAAGCAAACAAGCTCTACGCCAACATCGACAAGTG
CGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCATCGTGGGCGTTCGGACTGACCCAGACAAGGTCAAGGCCATATCAGCATGGCCG
ACGACCCGATCCCAAAAGGAGCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCGGGGTACGCGGGCTTTTCTAAGCCCTTGTCGG
GCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAAAGCACCAGGATGCTTTTGACAGCATTAAGGCCAGTCTCCAAGAGGCCCCTGTCTTGGCCCT
GCCGGACGAGACGAAGCCGTTTGGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACAGCTGGACATGAACGAGTC
ATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTG
TTCACCTTCTGGGGTCCCGGCCCTTCGTGTTCTACACCGACCACGCGTCCTTCAGGACGGCGACTAACTCGCCTCACCTCTCCTAAAGGATGGCAAGGTG
TCTGTCCTTCTTCGCGGAGTCCAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCGCTCTCTCGGCGTCCTGACTATAGGTTG
GCTCACATCACACGGGTAACAACGGATCTATATGATCGGATACTCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTCACGGTAG
GAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCTTCCTCTATTACCGGGTGGAACACAA
TGACCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGCTCGATATCCTCGCGGAGGCGCACGACGCGCCCTCCGGCGGCCACTTGGGCCGCGAT
AAGACATTTCTGTCGGTCCCACAGTCCTTCTGGTGGACCCATGGGTCGCCCGGTACGTTAAGACATGTGAGCGAGTCAAACCCGCAGGGCACTCTTTGGC
TCCACTACAGAGCGTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGGCACGGCAACATCGAAATT
TTGGTGCTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTCCCGTCACTGCTACGGGCGAACAAACCGCAAGGTTGCTCGTCGATGGCGTGT
TCCGCTATCACGGTCTCCCGGAGACGATTGACTCGGACCGAGACCCTCGGTTCACGGCTGCGTTTTTAAAAACGCTGTTTCCTTTACTGGGAACGCGTCT
GCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCA
CGTACGTGGTCGACGCAGCTTTTAGTTGTTAAGTCTGCGCTCAACAACGCGGTGCACGAGTCCACGGGGCCACGCCGTTCTACTTGAACGGCTTCCGTCA
CCCCAGAAGGCCTCTCACGCTTCGCGGAGACACTGACTCCTCTATTCTAAGTGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGAC
CAGTTTCGCTGCGGAAACAAATGGAATCCTTTATGGATACCAAGCTGAACGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGATAAACAAAA
GGAGTACTCCACCAAACATGGAGGAGGAAACTTAAGTGTATTCAAAGTGGGGGACTTAGTGTTACTAGAGACGAGGAACCTACCTCTTGACACTGTCAGC
TTTGTCGGCAGCAACAAGCTGAAGCACCGCATCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCATCGTACACCATCGACCTGCCAAAGTCAATGA
CGACGCACCCGACGTTCTATGTTGGACGTCTTAAACGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCATGGTCCAGCTCCCCAAAGCGA
GGGCGGGTCACAGACGTCGACGGGGGCGTCGGAGCAGGCGCCCAAGCCTCGGTCTGGACGGCAAAGCCGCGGTCAAGACCGTACACCGGAGGGGCTCCAT
ACGAACGGACCGCGGCGCCATTCGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCAAAGAGTGTGCCGCAGGCGGCTCCGGACGTGG
CAACAGAGCCTCGATCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGGAGGTGCAGGCTCGCGACCTCTCGC
CCCAACAGGTCCAGGCCGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGTCCAAGTGCAATCTCAA
GCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACACGGGCGAGAGTGGCTCTCGGGAAACGCCGAGTA
CTCGTACTCGTACGAGGGCACCTCCACCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGTAA
GCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGCCGCAATC
TGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGTTTGTTTTTGCCCGAACGGGGTACGGACGATGAATACACCCCTTACCCGCGCTCATTGTGAGC
GCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGACCAAGTGGGCAAAGCGAACACGAAGATCACGCT