Description :
From Genome Similarity Track
Location :
Scaffold_220:2712- 35815
Transcript NameFunction/comments
Phyta_totarag5786conserved hypothetical protein
Phyta_totarag5787cytochrome P450, putative
Phyta_totarag5788proline synthetase co-transcribed bacterial protein
Phyta_totarag5789conserved hypothetical protein
Phyta_totarag579060S ribosomal protein L21-1
Phyta_totarag5791hypothetical protein
Phyta_totarag5792hypothetical protein PHYSODRAFT_553661
Phyta_totarag5793hypothetical protein PHYSODRAFT_553660
Phyta_totarag5794sporangia induced hypothetical protein
Phyta_totarag5795conserved hypothetical protein
Phyta_totarag5796Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family
Phyta_totarag5797hypothetical protein

Sequence
33103 bases(100 bases per row)
AACTAAAAACCTGGTGAAAATCTATCCAAGAGTTCACTTGCGCGTCCGCATTCTGCTCGCTACATCCGGTTCGCGGCCGGCCTGCCCATGCTCGTGTATC
ACTGAAGTGATCGTCAAGCAAGCAAGGCGTCAAACCCTCGCGCCCGCCTGTCATCACCCTCGGTCGGTCAGCACCGCGTGTTCGTGCCGGAGCCTTTTCT
GCATTGTCGGATCACCCGGGGAAGCCAAACTGCTTCCTGGCCAAGCATGAGTAGCGGCCACACGTCTGGAAGACGCTCCAACAGCTCGGacagcgcctcc
accgtTGCAGGACCCGTGAGTGTTGCAGGCACCACCAACGGCTACGGATTCCGCAGTGCAGGCGGCGATGCGCTCTCCATTGAGATGCAGTTCTTGAACC
CGCGGAGACGCTTCCCGCTCGCGGACGAGTACTTGCCAGCTGTGCATGTCACGGATGAACAGGTGGAAGATCTTCGCGAAACATGCGAGCAACTCATAGC
CGACACGCTTGAGCTCACCAGCATGTTCGCCTGGgaggacagcaacaacaacgaccTCGTCGGAGAGCACCGTGAACAGTGGAAGGTGCACTACAAGCGC
CCGCATGTGACGCTGTACCGCAAGAAGCGCGGCAAGGACGCGACGGATGCCACCAACGGCGGCTTACGGCACTACGTGGTGAGCGGCCAGATCCATGACA
TGACACTAGAGGACGTCAAATATGGACTCTACTGTGACGCTACGCTGGACGAGCGCGCCGTCATGACGGACTTGTACCGCGAACTCTTCCTGGATGCAGC
GGTGCTGCGCAGCTTCGAAACACAGACACCAGTGGACCCGTTCCACTTCTTTGGTATCAAGTGGTTGGCTCACTTGAGCCCAGCCGACAAGTTCATATCG
CCTCGCGACTTTGCCTTCGTGGAATACTCACAACGTGTGGTCGGTCCCAAGGGTGAGCCGTTGCTTGTCAAGGTGCAGCAATCACTAGGTCCAGAGCATG
TCGACGCCATGAATCGCCGCGAGTTCGACCTGGTGCGTGCTCAGAtgagctgcaccaccatGTACCGCCACGACAAGCGTGCCAACAACGTTCAGGTCAT
CGCACGTGGCTACCTAGACCCATGCGGAAGCGCACCAGAAATTATGACGCGGTCGTTCTTGACACGCTTGGCGCCTACTCTTGTCGAGGTGGAGCACAGC
GCTGACGTCAAGTACATTATGCGCCACGGTCTTGTGCTACCAAAGGAGCAGTTTTTCGCCCGACGGAACGCGCTGAAGGCTCACGGTCTCCACTGTCTGC
AGTGCACAGCGTGCGGTAAGCGCTTCGGTCGCCTGAAGCGCCACCTGACTCAGTGCCGTGCGTGCGGTGAAGCTGCTTGTGGTCGCTGTCTCATGACGTA
TACGTTGTGTCTTCCTCACCACGAGTGCCGCAGTGCAGAACATCCGGGCGCTGTGATCCCGGGGCGCTTCTGCCTGCGTTGCTTGTACTCAGGCCGTCTT
GACCGCAGAGGCCAGCGTATGGACGACTTCCTGCTTGGTGGAACGATGGCCCCTTCTGGTCCGTCCACCACTGTTCCGActgtcgacgatgacgacgagg
ttgacgatgacgatgagtCTGTCGTGGAATTCGCGATGCTCGGCGATGGTCCTGGAGCAATGCATGCCGCCATTTCAGAAGCGCAGCGCTTGCAGCGCCT
CAAGCAGCGCTATTTGGAAAATGAGAGGCGCAAATACCTCAGTAGGACCCACCAGCAGTCACCGGTACAGCGTTTTGTCATggaccaacagcagcagatg
caccACTACGAGCAATCCACGCGTAGCATCCAACGCCCACCTATTACACGGAGGAGCAGCCAACCAACGATGAATGGCTCCGTGGGATCCTCTTCTATCT
CGTCGGCGTACAGCTCGCTGTCTATGTCTAGCTCCACGTATTcttcagcagaagctgcggtGGCCGCCACGGCTGCTTTGCAAGCCACGACAGGCTTTCA
CGAGATGGAGCACTCTATCGGCGAGCAGGAAGCGTTGCTGCGGTCGCTACAGAATGAGTACGCCAAGATGAGTATGAACCAGCGCTCAAATTCAAACCCC
GGTTTCAACGCGCAGCAGATGCGCGAAAACCGCTTGGCCGAATGGCAGGCTGCCGAACGCATGGCGCTGCCGGCATCGACATCCAATCAGTATGACATCG
ATGACTAAGACATCAGCGCCGGAAGTAGTAAGATTTTACAGAAGTGAGTGAGTGCAAACAGTATGTAGCTACTGTAGCTAGCGAGACCGATCCGGAAGTG
CAGACGGCCTAATCTATAAATTTGGCGTTATCTGTATTATTGTTGCGTTTGTCGTTGGTATATCAGTCACTTATGGAAGAATGGATACCTCGTACTACCT
GAGGCTGTGGTTTTTTACGTTATTCTTGGAATAAAGGATAATATGGCTAGACAAACTTACATGTTAATCCAGAATTGCCATATTCAAGAAAGGGATACAT
GTAAGGGGGGTATTATGATTTTGGGATGTAGCGGTAATTTATCAGTAATTTATATTGCGAATTTTATTTTTTCGTAGGAATAAGGAAAATTATTATTCCA
ACGAAAATGTATTCCATAAACGAAAGGCCTCTACTAAGCTTACTGTATCCACTTTATTGTTACCGGTACCTGTTTCAAGTTGCCCACTTTATTTCAACCG
AGCATCCTGTTAGCGACGTCAAAATGATCTCGATTGGTGTGGAGGCGACAACAGCAATAGGAGTGACAGTCGCCAaaatatacatgtagaactagtgtcc
tgcttcttctcttcaATGTTAAGCACATCACTTGCTGATGAGAAAACATCCAATCTAGATAACCAGAGGCGTAACCTTCACGTTTAACGGGCCCTTAACT
GGGATGGTGAGTGAAAACTCGTAGGTCAGTTTCCACGGGTCCTCGACTGTCGCGATATCGAATTTGCTCAGAAGCGTGGCCATGGCTAGTTTGATCTCCA
TCAGCGCAAATCTCTGACCGATGCAGACGTGTTGGCCAGAaccgaagctgctgaaaacAAAGGGAGACAATACGCGAAGCTTCCCTGTGCTTGGATCGAT
CATGCGCTCCGGCTTGAACTCGAGCGCGTCATCACCCCAAGTTCTCTTGCTGCGCGCGTTGCAGtacgacgacatcatcatGGTTTGACCCTTCTCAATG
AATGTCCCATCGCAAAGTGTCGTATCCTCCATGGCTTCCCGAACGATAAAGCCCGTGGACGGATGCAGTCGAATGTTTTCACGCACCACAGCCTCCAGAT
ACACGAGGTCACGAATCTGCTCATGCGTCGGTACCTTCAGCTCACCATTGAGTAGCCCCGGTACCTTCTCTTTCATCTCGTCGCGGATCTTGCGCAAAAC
CTCCGGGTGGCGGTTCATGTTGACGATGAACCAGCCCATGCTGTGAGCTGTCGAGTCTTTGCCGGCGAAGATAAAATTTACCACCATGTCGCGCATGATG
TTcgcgtcatcgtcttcgaTGTGCATGCCTTCCGTTTCCCTGAGTTTACTCTCCATGACCAGATCTTTGACATCCATGCTCTTGCCATTGGCAGCGAGCt
ctgccttcttctgcatTGACTGATGATCACATCACTGATAAACTTATGAATGATCTTGGTGTTGTCCATGAAAATCTTCTCCCAACCTACGTTCAGGCAT
TTTTTGAGTTCCCAAAGCCACAGTGGTGACTGAAAGCGAACCCCAAAGGCCACCGACGCTTTATCAAATGCTTGCAAGAACTTGTGGTCTTCCTTTTGGT
CAGGGCTGTTCTTTAGAGTGTCAAGCTCGAGTCCGAATCCAATCTTGGCGATGGTGTCCATGGTAAAGTGACTGAACCCCTCCTTAATACTGCAGATCTT
GCTGCGTGTGGCGTACAAGTTGAGTATATCTAAGAACACGGCTAATTTCTCGCGCACCGTAGCTTCCATGACATCTTTCATCATCTGCATGGAGAAGAGG
TGGCTGGCTGTCTTCCGGTGGTAGAGCCACGGGTCGCCATCTGCAACGACCATCCCGTTGCCGAATATATCTTTGCTAATGTACTGCCCCGTGGGGCCGC
GTAGGAACACGATGGCCTGTGTCTTAAGCACATCTTCAAACGTTTCTGGCGACGAGAGCACAACGGTGGCCGGGCATCCAGGGACCTCAAACTTCCATGG
TCGATTACCGAACTCGGTAGATTGTTCGTGGAGCCAGTCGTGGAAGCGCTCAACATTCCCGCCGGCGTCCAGAATGTTCTTAAGAATTGGCAGCGTGCTT
CTGGGCATGGGTGGCAATTTGCGCTCTTTCATCTGATGTTTCTTCGCATCGTGCAGTAGTAGTGTCAGTCCGAAGCTCACTGCCAGTACTGCTGCGGTAG
CAATGGTTGCGTCACCGAAAATGGCCGAAACAGATTTCATGTTCCCAGTCAGATTTACAGTTGTGTGATGCAACCGACGAGCGTTCAAAAGTAACCAAGC
AGGAGTGTTCATGAGTGCAACTTGAATCTTGAGTTCAAAAGCTGCAGTGAAGAGTACCAacacatgtactgtacttcgaagtataaaTTTCCGTTGATGG
CCAGCCATTGTCCAAAGGGTTTACGGCCACGGAGTGGTAAATTACAATCATGAGATAATTATTGAGATGGACTCAATAATTTCTCACGATTGTACGTAGT
GTAATTTCAAGTGCCTTGTACTGTACAAATCTGATggagttgctgttgttggcacGGTGCCTACAGCATCGTAAAACAAGAAACACAGAAGAACGCTGCT
ATCAAGTTGTCTAAAGTAAGTGCATGCAATTGAGATACCGGGAAGTCCTGTTTGAAGCCCTTCCTCTCTTGCAGGGAGTGACATCGTCATCAAAATAAAG
TTCTCATCCCCGTACTTGGTCGTAGAGCGCCGTAAAATTGACTCCGATCGCATCCAGACGATCTCTGTCTCTTTTCACATACGAGGAGTATGCTCCCGTG
TGTCGGATCTTCATAAAGATGTTGCCTAGTCTCAATCCGCGGGTTTGTTCAGGCCAGCGTTCTGAATCGGGTACAGTGAACTCAACCGGCACCCATCCCG
ACTTGTATACTTCGCAGTACGTTTCTAGCGCCGGCATGATTCTATCGGTCCAACGTTCGTCTTCTGGGCTCCACACGAAGTCGATCGCCTTTAATTTGTC
CTTGTCTCGATCCACCATATCGTCGTAATTGCCTCTGCAGCGCATGTTGGCGACAGTCGCCCCCAGTCGCATTCCCTTTGTCCCCTGTGGCCATTCGTCA
CTGTCCGGCACGACAAAGTTAAAATTCACGTTGCAGTGTCCAAATTCGCGACTAAACGTCGCCAAAGCCGGGAAAATCTTCGTGTCCCACATGCGGTCCT
TCCAGTTCTGCGTCGAGAAGTCAATCTTGTCCAATTCCTCCATAGAAGACTCTCGTTGGGCTTTGTAAGTGTCGGCATATCTCATGCTCATTGTCGTCTG
TCCCAGTCGGAACCCCCACAGGAGTTCCGGCCACTCGTGATCCCCCGTGGGAACCACAAAGTCTTTGGGAATGTCACTGTGGCCATTGATCTCGTGGAAt
ttctgcagcgacggcagcaccagcacttcCCACTTGCGTTGCCGTATATCCCACGGAAAGTCGAGGGTCTCCAGGTCATCGACCGCAAAGAACGGCAGTC
CCTTTCCCTGGCTCTTAAGAACGCGCAGGTTCTTGCAATGCATTCCTAGTGGATAACCCCAGGTCTCCTGCGGCCAGTTAGGGTCTCCGTAGGGTACCAT
GAACTTGAGAGGGATCATTAAGTGCTTTTCCAAATTCAGGAAGGTCTGCAGACTTGGGGCGACTTTCTGTACCCAAATGAATGCCGAGCGCAGGTCGATT
CGAGCGGGTCGACCGGCTGGGGGGGATGACGAGACGCTGGTGCATCGGGCGATACAATATTTACCGCCTGGGGTTGCGTGTGGGCGGCATACCAAGCCAC
CGCGTCGAGCGAGCAATGCACTCAGCATTGCCTCGAGGCGTGTTGACACACACGAGTTTGTGGTCACGGCCAATAAGAGATAAGGCACAGAATAGTGACT
AATGGTACAAGCTAGTATGTGTAGTTTGTGAGATGTGATGTGGTGGACGTaaaggcaagttgaagcaggaGTGATTGTCAGTATGATCTCACGTGGTTTC
GAAAGGGTCCAGCGTTAACTATTTTTGAGCCTGTATGGGATGGAGATTGCTAGAGCAATCGCAGCTCATTCGTTTCAAACGGATTGATCTTGATTTGGAT
CTAGGGTGAATGAGGACGTTGGCCATTTCTCCACTCGACTGCAGTAGCTCACTCTCACGCACAACAAATACCTGGTGGCTTTTGAAGGCGCATCCTCAAG
TCCGTAAAGATGATGACTGAAAGCAACAACCTGTTGTACCATCCAAATGACAGTGGCTTTGATCGCCTAGAGGAAATGGGAGGCGGAGCGCTGACGCGAT
ATCCAGTGCTACGGTCAGTTCCAGTCCCGACGCCGCGACCGTGGAGTACTCGCGGGGCGATTGCGTTGCTCATAGTGTGTGGAGTGGTCTTCGGAGTCAT
TGCGATCGCGACATTAAAGGGCTCGCAGTCTACAAGTGAGGCCACAACTGCAGAGGCTTCAGCTGGCGCAAACAATGAAGGTGTATCGATCATTGGCGGA
TCAGGCAGTGTCGAGCCCGGCGCTGTAGCGAGTGGATCGTCGTGGCTGGATGGCTCTACGTCTGATTCATCGGCTGATGACAGCCCGCTCATCTCGTCAG
GTGACACTTCAGGCAACTCAACTACTGGTTCGCTACAGGTGGAAGAATCAGCAGTCGGCTCAGATGACAGCACgttcgcctcctccttcgaGGAGGCTCT
GGCCAATCCACTCGAAAACTGGATTGGCGACTCGCAACTCGGATCTTTTGAAAGCTCGACTTCGGACGCATTGAGTGCATCGGCGGACAGCATGGACAAA
GCGTTGGTCTCTGGCTCAGATTCCACAGATGCGTCCGTGGATAACTGGCTTGCTGAGTCGATGTCAGGCTCGCAAGACGTCTCGAGCGATGGTAGTGCTT
CCTCTGTCGATTGGCAAAGCTCATTCTCGATGAGCGATGAGGCTAGCGACTCGCTCTCTCGATCTGAAGACAGATCACTAGATTTTTAGGTACGGTCGAG
AATGAAGCGATATTAATAGCAGCTCGCATCGTTAATTCACTTGCGAGTGCAAGTCCACGTAACACATACTTATATGCAAATACACTCATAACGTTTAATC
ACTCTGTGTATCGGTGTGGTGGCTCGAAGCTTTTTATACTTGATCGCCACCTAGAAATACTTCAGGTAGATACCAAACAGAAACTTGGCTGTTAATTAAG
CAAAAGACGACTAGCAAATAGTGGAGCAGCCAGAATAAGATATTTGGATAAGCTTATGTAGGAGACCGATCGCAATCTACTTCAATCTCTAAACTTATTG
TAGACGGCAACTCAAAGACTACGAGGAGAGACATCAATAAACATTGTCAGCATCATCACGTGCGCAGATCATCGTTCTCAGCAGGGACCCTCACCCTTCC
CTGAAGGTGCTGGCAGATCGCTTCGAAAGACTAACATGTACGTCACGCTTGAGTGAAAGAATAACAACTTAAATGTAATGAAGGCAAACATCACACAATC
ACAAAGCGAGTGGCGGAGCGCGAGGTGGTTGTACTTTTATATCATTCTCCACCGATATACGATAAGATGTGGTGTATTGGAGAAACGAACCATCGTGGAC
CCGATACTCATACCCGGCTGAGGTGAGGGCCTCACTTTGAGGCATCCGGCGACACGGTACAGTTGTCATAACTGAGTCCACTTTACGTGTATGCTTTATC
TTAGGTTTTGTATTTTAAGCCACTTTGTGGCAGCGTGTATTTTTCTAGAAGATGGCAGTGGCGAAGAACTTGCTGGCGGTGCGTgccaaggtggcggagg
cTGTAGCCAAGAGCGCatggaagcagcagtgtACGCTGGTGGCTGTGAGCAAGACCAAGCCTCTGGAGGATCTGCAGGAGGCCTACGAAGCCGACCAGCG
CCACTTCGGCGAGAACTACGTAGGTATACCATATTTCGGCATTTTATGATCTATTTATGGCACTTATACATCTATTTATGGTAATTTGTGATACAGATCC
AGGAACTGgtgcagaagacgccgctgctgccggccgACATCAAATGGCACTACATTGGCCATGTGCAGTCCAACAAGGCCAAGCCACTCGTGCGTGACGT
GCCCAACCTTTTTgtggtggagacggtggactCGGTCAAGATCGCCAATGCACTCAACAGGGCGTCGGGCGAGTTCCGCACCGAGAAGCTCAACGTGATG
GTGCAGGTGAACACCAGTGGggaggagcagaagtcggGCATCGATGCCGACGGTTCAGTTGAGCTGGCCCGCCACATCGTGACGTCCTGTGAGCACCTGA
ACCTCACAGGGCTCATGACCATTGGTCGCTACGGAGACACCACGTCCGAGTGCTTCGACCGCTTAGTGGCCTGCCGTAAGCTTGTGGCCGAGGCGATCGG
GAAGGCTGAGACGGATCTGGCCCTCAGCATGGGCATGTCTGGAGACTTCGAGCTCGCGGTGGGTGTTGTTTAGTGCTGGTTTGGAAGTTGGTGTTATGGT
TTGTGGGTTATGAAGTGCTGATTCTTCTTTTGTTGTTGCGGGTTAGATTTCTTGCGGAAGCACGCACGTTCGTGTGGGTTCGACCATCTTTGGTGCTCGC
AACTACGCTGAGGACTAGATCGAAACCAGTGGAAAAAGAAGTTGACAACGTGGTCTAAATTTGTGTTAGAGCAGATCAAATGCCAAGGCAGATTGCAAGT
CGAGGTTGCCGTGCTTGTTGTTCTCGGACCATTTGGCAGCCACCCGCTTTGCGTCCTCCGTAGGCATGCACTCTTTGGCTGGatcctcctcttctttttg
ctgttgttgatgccGGTCAAGTCTCTCTTTCTCCTGTCGCACGATGTCTTCCATGTCGATGTACGTTGTTTCCGGCTCGTTCGGGTACATCTCGCGCCAC
GTCTTGCCGGCCTCttttgccttcttctgcatTTCTTCTACCTCAGCACGCCGCTGCATCCGTTTGGCTTCCGCCTCCTTCGCCTTTTGCTCGCGTTCAA
TTCGCCTCTGCTCCAAGATATGCATGGACATCATATCCTTGCGATGGAATCGATCTTCAGGTagctcttcgtcttccatTACAGGGTCCCATCGTCGAGC
AGCCTTTGGTGCGGATCCATTACCGTCATTCGACGGAGCGGCATTGACAAGATGGAACATCTCCACCAGTGACTTAGGCTTCTCGATgacagcatcagca
gtcGTTGTTGGTCCACCTTTATTTCCTGAAGCCTGTGGCTCGTTTTCTTCGGCTAACGCTCGCGCGAGAAGCCACGGGGTTGAACCGCAGTCAGCTCCAA
GAGTATCCCAGGACTTGTCAACCAATAATGTTATCTCCATTATGTTGCGGGCCTGATCTAAGCGAACCTTTGGCGAGTTCACTTCTACAGGGTACGGAAG
AAAAATTTCTGGGAAAAAATAACACCGAATTAGCGTTGTTAGTCCTCACAGTGCTGAAGGAATCTTGAGGGTTGCACTTACCCAAGTCGTGATGTGTGGC
AGCTTTAACACTCAATAGCTCGACTTGCAACTCCAGCTCGATCTCACTAGCCGCCCGCACCTTGTTTTCAAATTGAACGGAGACGATCAACTGATCCCCC
GCTTGCTTAAGTACCTCGGGTGATAATGGTGGACTGTCCTTCATAACAGAAGAGAGTCTTGAACAAATTGTGCGGTCATCGTTGCGCTCCTCGAATATTT
CATAGCGTGCTGTAGCTGTCTTCGGGACGTGTGAGGCACTTGTTTCCTTCTGTGTTGTAGATTTTGAAGGACGAGTCTTcttcgaagctgctgaattACC
CGCGGCAACTTCTTGGATGATTGGTGCCTGTGTCTTGCGAATATAGTGCTTTGGCGGGGGTAGCTCACCACGGTATGTCAGCCGTGGCAGTTTGTAGCGA
TCGTCGAGCTTGATTTTGTACTGCATCAACCAAAAATGTCAGTTAGGTTTGCTGGTCAGTTCCAACCGATAGGATCGCACTCATACTTTCTGATCGATGT
ATTCGATCGCCAGTTCACACACAAAGTTGCGGAAGGCGCCTGTTTTGTCTGCTTGGCAGTCTTCTACGACTTTCGTGTTCACCGCTACGTCAAAAGCCAG
CGAACTCACTCCCTTCTTATCCTTGACCTCATGTGGCGCACCTAGACTCAGTGGCACGTGAATTCCCTGAGTATACAGAGTAGATTGTGTCAGTTAACTA
AGAAATGTTCCAGTGGCAGCTGAGAGAAATCTTTTACCTCTTGCTCCTtgccctcgtcgtccagtttcttcttctccgaaAACGCCTGGATTTCGTCAGC
AAAGACTACATTCACGAAAACCTGTTACACCACATGTCAACAACGATCATCTTAGTTTGGCAATTCCGAGATCCTTGGGTTCCATATCTCAATTTGAACA
AGGGAACGGAACAGCCTTCGCACctttttcttgttcttggcgtCGTTTGTCTTCATCACGAAACCAGGTTTCACATCAATGTGCATCTGCCAGCAAACAG
ACATCAAAGCTTAGCTTTTTATCTACTGTACCAATGCAAACCCTCTGACACTCCAATCTGATGCGAATTCATATCGTACCCCTTCCGGCGTGGCTTTCAA
GCCGTCCTCCCCCATAACCTTGTCGCCTGGAAACTGCGGCTTAAAATCTAGACATCATCCATTGCAAAAGTCACCACAAAGCATCTGGTGAATTTCTTGG
CAGAAAAATCTCGCTCGACTGCTATGACTTCAAACCTGGCGAGTtcgtgtctgcagctcctcctcgttcACCGGCAGAGCTCTTGAGCATGTCGAAcagt
gctgcatctgcgtcgCCTTGTTGTACACTAGCAGCAGCCTCCGGTCCCAATCCTGCGGCCTGCAGTTGGTTCTGCATCGTGGCGATGAACTGTTTGTAGC
CTTCCGGGTCGGTCTTCTCCAAATTGtccagccactgcacaaCACAGTCGCGAGGCGGTGAGAGGGGGTTCAAGGGCCATTCAGCGCAGAATTTATAGCT
CTTTATTATGCACCAACAACGGGGCAACGTACATCAGCGTACTGCTCCATGGCCGCGTCGTCCATTGGGGCGTTCATAGTTGAGGGTGACGAAGAGTCAC
GAAATGTGGAAATGGCTTTGGACTCGCGATGAAGTGCAACACCGAAGCGAGTCGCATAAGTGCGATATGATATTGGATAGGTCGTGCTCTGATAGTGTTG
CTGTTTGGTGTCAAAGTGTGGAATATGACGAGGGCGAGTGCTGGTAGCATTTCTATTTCTAAAGCCAGGCTGACGTGAGATGGAGGACAATTGAAAAGAG
CTGAGGACACCGTGGATTCGACTCGTTCTTTCATTTAGCCCAGCTCGTTGGGGTTACTACGACGTGCCCGGGAGCGACTGTCAGCCTCGCCACAAGCCGA
GCGCAAGTGTCCCAACAGTGCGTTGAAGCAAGGGTGGAGTACACCAAAGCCACTTACATGAGGTCCACGAACGGCTGCGCCGCCATGGTGATGGGCTTGG
TGCCGTGGGCCTTCAGGGTGTAGGCGGCCTTGGGCTGCACGGGGGTGCGCTTGATCTGGGCGCGGACGCCAGTGGCACGGgcctctttcttcttcagctc
gttctccttgaCGCGCGTGAGGAAGCCCAGGCGGCACTTGGACTGGTGCACGTGCTCAATGCGCACGTTGATGTGCTTGTGGATGATGCGGTTGCCCACC
ACCTTGTTCACACGCACGCCGACGGCACGCTTGGTCACGTTGTACACGCGGCCGGTGCGGCCGTGGTAGAACTTGTGGGGCATGCCCTTCTGCACGGCAC
CGTTGGCCTTGATGTCCACGTAGTCGCCCACCTTGAACGTGCGCAGGTACGTCGACATCTTGATCATGCCGCTCTGACGGAACGGACGGGCGAACATGTC
GCGCGTGCGAGCGCGGTAACCGAAGGAGTGCGGCATCTTTGACtaagctgaagcagcaccaacaaccaAAACCTCGTTAGAAACGGCATTTTCCGGCATC
ATCAGAGCGATCCGAGGCCTGCAACGTGAAGGGGGGGATTTAGCGGACACGGCAGCAGTGGGGTCAACGCTGATAACACAATAATCTTCTTGGGGCGGAG
CGTCCTATGTCCCCTAATGATTCTGCAGTCGTTGGCCTGTATCTCTGTCAATTGCTACACTTTGCAGCTCGTTGTTGCGAGCGTCTCCGTCCCAGTTTTG
ATTGGTGTATCTGTGCATCCATGTGTCCCCACTGTTCGTCGCTGCCTCATTGCTCTCCCTCCACAAGGCGCCGCTCCATACATCGCCTCGCTTACCTGCA
AAAGTCGAACGAGACAAGAAGAACTGGGTGAGTTGCCGAGGCTTGGGGCGGCGTGTGGGCCGCGAAACTATTGGCCGCGGAGGCGCCAGtatacaaacac
caagtgAAAGAACCCGCGAGCCAATCACCAGTTAGAAATCACATACTTTAAGATCCCATTTAAGTACGAATATGGGTTTGAAACCCGGCCCGATACGGGT
TCGTACTTTAAACGTAACGTACCAGCGGGGTAACAATACTGTatccacagcagcaatatggaggacgaggagttcgGCGAGGATGTGCTCGTGACGACGC
GCACGGGCGACGCCAGCGTCAAGGAAGAGGCCAAGACTGAAGAGTCCAGAGCCACGTGGGAATCCAGCGAGGGAGCTGAAGTGAAGGCTGAGAAgcccaa
ggaggaggaggaggaagacgaggacgaggagctctaCGGCGGCGTCTCCATCAAGCTCAACGCGTCCGCTACGTCCCAGGCGGAGGCGGCTGCAgcctcc
gctgctgctgctgctagtaaaggagcagctgctccCAAGCCCAGCGATGATCCGGCAGCAGAttcagacgacgacgaggacgacgaagacgtggcCATTG
TGCTGAGCACGAACCACGCAGGCAGCAAACCGACGCTGCGCTTCACAGGGGGCGGCAATCGCTACGTCCGAGGCAGCTTTGGAGGCCCGCAACATGGCGG
GTCTGgagctccaggagctgcagcgatggcggGCTCTCAGGCTGGAGAGTTGGGCGGATCGGCGGCTGATGGTGTGGATGACATGGCCTTGTttggagga
cgacgcacGGCGTTTGACGTGGATATTGACCTATTGGAGGACAGACCGTGGCGCAAACCGGGTGTGGATATCTCGGATTACTTCAACTACGGCTTCGACG
AGCACAGTTGGAGAGAGTATGCTGCACGGCAGCTGAGATTGAGACGGGAGTTGGCGGTGGAGAAGTCGAGGGAACAAGCTTCGCGACAGGCAGTGAACGC
TGCtaaccagcagcaagcgatACGAGACCGTGACGCTAAGATGCAAGGACGCGGAGGGGGTGGAATGCCCCCACGTGGATTCCCCGGGCAGATGAAATCA
GAGGGTGGAGACGAGCAGAACGCAGGTGGTCGGTCTGGAGAATGGGGCGCCGGTGGAAATGGAGGGATGCCTCCGATGGGCGGCGCACCGCCTCGAGGTG
GCTTTATGGGAGGGCCACCTCCGCGGGGCTGGCACCCTGGCATGGGCCCCCCACCAGGCTTCATGGGTCAGCAGAACTGGAATGGTCCTCCGATGGGTGC
GCCATGGAACTCTGGACCAGGGAGAGGACCTCCTTGGATGGGCGGACCCGGTGGCGGCAgaggtcgtggtggtggtcggGGCGACCGCGATGATAGACGA
GGTGGCATATCAAGAGAAGCAAGTCGAGATCGATCAAGATCCCACGATCGCCCTCGCCGAGATGACTCGCGAGGTAGTGGACGTCGAGACAGGGCTGGGG
GCAAAGATGCTAGTGAGAAAGACCGAGGTCGCGATAGAGACCGGGAACGCGGCCGCGATCGTGAACGGGGCCGTGAGCGAGATCGTGGCAGTGGCCGTGA
TCGTGATAGTGGCCGTGAGCGAGATCGTGATAGTGGCCGTGAGCGAGATCGTGGCAGTGGCCGTGATCGTGATAGTGGCCGTGGTAGTGGCCGTGATAGT
GGCCGTGACCGTGATCGCGATCGTCGCCCTCGAGAACgcggaggaggcggagcagGAGACCAGGAGAAAGAGCGGGGAGGACGCAACCGAGGAGACCGAG
GCGGGCTCTCGCGATCCCGAGACCGTGATTCTCGTAAGCGCAAGGATCGGGATGAAAGCTCTGGCGGTAACCGAGGCCCCGGCGACCAGCGCCACAAACG
GCGGCATTAGACGACAAAAAGCAAGCATGCCAGCGACTACAGCACCATTCTGGCTGACTACAGGCTACCAAGATATCAATGATCTAACAAAAGCAAGTAA
GGAGTGGCATTATACCTTGGTGAGTATTCTTTTTCGCATCAACTCGTTGTTTACAAGTCTGCCGAATCGATGCAACTGTGGTCTAAATGTCTAGATCTGC
TTGTGCAGCCAGAGCTCGGTCTCCAGCTTATCGAGGTCCTGCGCCGTCACCTGCAGCGCAATTACTGCAGCGCTCTGGATGGCGTCCACAGGTACGAACG
TCATGCCGGGCATGCTGTTTACTTTTCCTCGTGCTGTAACAGTCTCGTGATacgtcttggccagctcctcctcgcttgAGAAAGCTGTTGCCACGTAGAA
GGTGCGCACATGAATCACGCGGTCCCAAGGCATCAGCGCTTGCACTAGGCTATCCAGCACGCATGCCCAGAttccttctgcagcagccttAGCCAACGCC
CGTGTGTCTGAAtgttcttcatcgtcttcaactGTAGCGGTACACACGATCTGGCAAAGAGCTCGCGGAACCATACTGCTTTGCCAGTCGAAGCGCAGGT
TGTTTGAATGGCGTGTGCACGTCAAGCTGCGTGGGACCAGGTATTTCAGCGCGATGTGCGTGAGTGCCTggagctccacctccactaGAGCATCGCGCGG
CAAATGTGACACCTGTACGACCAGCAGCGGAGCCTGCTTCACGAACTGCAAGCGCGCTTCGTCCTtgtcaacttcttcatcgctcTCATCACTGTCGTCC
AAAGACTCGAACTCATCGTCCAACTCGGCGTTCGTAATGAGGTTGCGACGGCAGTCAGCTAGCAGACGCTCCCGAGCTTCGCGGTCGTCAGGGTTACCGG
TGGTGTAGATGACACCGGAGCACACGTGACGGAGATTCGACTGAAGCGCTTCCAACACACGGCAGGCGTTGCGAAAACATTGCGTAGTCTGGACGGCGTG
GTCACCTGGCACGAGATCCATAGTCTGAGGGTGCAAAGCGATTTGACCAGCCAACAGGATGAGCGCTCTGTGGAGCACATTGGCTTGACTGTATGGGCCA
ATGCAGCACGGCGCCCAGGCCGAAATACTCTTCACATGCAGGACGTCGCGGCGTACACGCAGGGACTGCAACTTTTGTTCACCACTGCCGCGCAACGCGA
AACAGTCCAAAAGCACACGGGCAGGCACATCTGCCAGTGCCTTCACTTCGACGCAGCTACGTGATGGCGGCAGGTTTTGTCCGAGGTATCGGATATACTC
GGCGTTGAGCTGACCGAATGTGGCCATATCGTGAACGTACAGATGCACGAAGCACATATCGGCCAGCACCATGTTTTGACTCTCAAGGATGGTCTCCAGC
TGGGCAACAATATCAGCCAtttcctcctccagcgagATTGATGCATCACCAGCCTTGCTGCTCATAATGCCCGAAAAATGCAATTGGTCGCGGAACTGAC
CAAAGGCAGGTACAAAATCTTTTGCAGACTGCGGGTTCAGCGCAAGCACGGTGGCGGGCTTCTTGTCCGTGTTCGTTGCGCTATTTGGTGGTTGAGAAGG
CGAAGGTTCTGGGATCCGTGAGGCTAGTTGCGAGGGGTCCGAAGGTTCCTTATCCTCCAGATGACACTTGTCAATTGACAGAAACGCTACTGGTGCGATG
TAGTCGTCGGAATGAAGCACCGTATGGCTTTCATCACTTgaaaggagaagaaagcaTGTCACAACGCTAGCTtttcgaacagcaaaaatTATATCCATAT
AATCAAGACGTACATGACgatgcgcttcttgaagaGCGGGCAATCCAGCGTGAACGTCTCGTActcgccaccttcgccacAGACGTTCATCTGATACTTC
TCTTTCTACACAAGATACCAGCACAAATACGTCACGCcccaaacaaacaaaaatgAGCAAACGGTACGCCCAACGTTCAAATCGCTCGCCCAGCTCCGTT
CCATACCAGCATCATGAGTTGTGGTTGCAGCTCCGCAATCGTCTTTCCCAAATGCCTCTGGGGATGCAAGCCAATGGACGCCACCTTCACCAGGATGGCC
TCCATCTCCGAGTCGAtcatctcctgcagcaactccgtCTGCTCGCGACGCCACAAGTATCCAAGCGACGTCAGTCCCAGTCGCGAGCACCTGTGCAGCA
ACCACGTCAGCGTCCCAACGCCCCCTAACTTAACAACTCACTGCACTCACACATTCTCCACTCGGTTCCTCTGGTAACTGGAGAAGATTGCGCCGGTACA
GACGCCCTGGACGTCCgggaactgctgctgggccttTTGCAGCAGGCGGAACAGGTCCTCGACCTCGTCCCCAGCCGCCGACTCGTGGTAgtcgatctcc
gtcttcacTGCGGTGCCCGTGATTGTCTTCGAGaccagcggcagctccatGCTCTCGGCGATGAGCCCCACGGTCTGGTGGCCGACGCTCTGGAACATGA
ACGAGTCGATCTCGGCGTCGTCTGCCGACAGCTCTGCCGGCGGATGCAGATGCGCCAGACACACGATCTCGTGGCCGAAGCGCATACACTCCATCATGGC
ATAGCAGCTGTCCTTGCCGCCGCTCACgagcgccaccacctgcaTCGCTGTAGTCTACTAAGTAGGACTTCGAGTCGAGCAAGAGGAAAATGAGAACACG
ATCAGCATTGACAATTGAGTTGGTCAGGAAAacaatgtagccatctcagcttcgactgctATGTGAACCACACTATGGGGTGGTTTACACACCATCATGG
TGTAGAACATCATATTGGTGTGACCACACGATGGATGTTGTGATGTTGCGACAGTCACTTCTCAAATAGAGGGCCCCTTCCTGCTCACCGAGATGGCTGC
GGTGCGTtccgtgctgctgagcgacatACAGAGCGTCCTGAGCCTGGCGCGGCGCCGCCATGGCTACCTACTGTCCGGCTCGACCAGTCAGCACTCGAAG
CAGGTGTGTAAACGTTCTTCTGTGTCCGTTAACTCCACTCCAATAAGGTCCACAAATCTCTAATATTCGCGTTGATATGGCCGTAGGAGAACCCCCTGGC
GGTCTTCCAGAGCTTCTCACTGCTGCGAGGACGTCTGCTACGTTGCGAGAGTGTGTCCAGTGTCTTTTACTGCGTTAGTAGCCGCCGAACGACCTCGTTT
TAACACTTTTCGACCTCTTTTGGACAGATATGGCGGAGCTGTCGCCTGTGAACGTCGTGAAGCCGTTCCTGGACGTGATCCGCCATGAacacgccagcag
cacagtgACGGGCGCTGCACTGCAAGCTGTGATGAATTTCCTGCACTCGTGGCCGTGGACAGACGTCAAGGACCAGAACGCGGCGGCGGACGCCGTGTCC
GACGTAGTGGACGCTGTGAGCCACTGCAGATTCCAGGAGACGGGCGTCGAGAGTGACCagaacgtgctggtgctggtggtccATGTGCTGCACGCGGTGG
TGCGCTCTCCCTGTGGCGCCAGACTGTCGGACCACTCGATGTGGCAGCTGGTGGAGTCGCTTTACGCTCTCAGTCGCGGCAATCGACATGATGTGCGTGC
TGTATTTGTTGGTTAATCATTATCGGGTCTGGCTGGCGTGAGGTACATACTGATAGCTGTGTTGTATGCTTGTGCAGCCGCATATTACGCTGCCATTGCG
ACCGACCGCCACGAACTTCCTGCATGACACGATAGCCTTCATTTTCTCGAACCCTGCTGTCTATTCGGACCtggctcctgctgctgaggctgctaCTTTT
TCATCGGAGCCTCTCAGACCGGGATTTGGATTGCCGTGTGCAGTGAAGATTGTGGGCTTTCTCTGCCAGAAGTTGCACCAGCGGAACTATTCGCCACCTC
CCGCTCCAGAtgcacctgctgcatcgactgGAAACACGACAAGTCGGCGTGAAGTATTGCTGTCCTTCAGCTTGCTTCAGCGTGCACTGATCGCCTGTGA
CGCTGAACTGATTACGAGTGTGCCGTCGCTGATGCTTTTCATCAAGGACGATCTGTGCAGCGCCATTTTGCGCTACTGCCGTCTAGGGTGTGTACTGCTT
TGTATGATTCATATTCTTTTTGTTGTGTTGGTCTAATGTTTGCATTTTTGTTTATAAATGATGTGCAGCGCCTGTgcggagctcaagatccCAGTGGTAT
GTCTCGAGCTTATCAGACTATTGTGGTCAAAGCTCCGTTCGGAGCTCAAAATGCAGGTAGAGGCGATCTTTAACGGCGTGTTCTACCACACGCTGCACTG
GTGTCTCGCAAATATGGATGTAAGCAACCCAGATTTTCCGCGTGGGGATGATGCGACTCCTTCTACTGGAAGCGTAAACGATCAGACAGACGACAAACCC
GTTACAATGGTCGATTCCGCTCTTGATGAGTTCTCCAGAGAGATGCTATCCAAGAGCCGGCTGTACAACATCTCGTTTGAAATTCTCGACTGCTTGGTGG
ACTTGCTTGCAGAGGCTACGCTGCTGCCCGACTTGTACGTGAATtacgactgcgacgacaaTCGCTGCGACTTGACGCAGAATTTATTTGAGCTACTTTC
ACAGGTTGCTCAGCAGTCTCATGTTGCTTGCTTTGAGTCGCACGAAGAAACGCACTTCCTGTGGGCTCAGGCTATTGGAGAGATTGCTCTTCGTGGAATG
TTCAATGCACTGTACGTCGTACATCTCCGTACGCACCCAGAGCCGCCCACAGTCAGTGGTGACAGTAGCAGTGGAccgagcgacgaggaggttgATGAGG
ATACGCTGCTGGTAGATCAGGAAGAGCAATCCCTACCAGCCGATGCTGAAGAGTTCGCCTCTGCAGAAGTGCTGTTCAAAAAACGACAGCGCAAGAAGTT
TTTCCAACACGGCATTCAGGAGTTCAATCGGAAGCCACTGGCAGGAATCAGGTACTTGCAGCAAAACACTTTTCTGCCTACCCCGCTCGACAGCATGTCT
CTTGCAACGTTCCTGCGATCTCTTCCTCAAGGTCTGAACAAAAATTCGGTGGGTGTGTACTTGGGAGCAATGGGCAAGGAAGTCAAGGGCTTTGAGAAAA
CTGAAATCCACGAGGCCGATACTATGGACTTCCATCGCGACGTCCTGACCAACTTCGTGCGATCGTTCAATTTTGAAGGAGAGAGCATCGTTACTGCGCT
GCGCATGTTTCTCGCGAGTTTCCGTCTACCTGGAGAGGCACAACAAATTGACCGCATCTTGAACACCTTTTCGCTCCAAGTATACGAACAGTGCCGGGAA
CGATTCATCATGGCGTCGGTGGACGTTGCATATTTGCTATCATTCAGTCTGATTATGCTAAACACAGATCTGCACAACCCGAACATCCGATcagacaaga
agatgaagctggcCGACTTTATCAAGAACAACAAAAACTATGGCCAGGAGGTTTCCAAAGGTCTCGATTTGCCTGAGGACTTTCTGACGGAGTTATACAG
CACCATTGCGaaggacgagatcaagacgtTTGAAGACGGTGGCAAGCACGGCGAAGTGACAAGCGATCGATGGAAGGACCTGCTCAATCAAGCAGAAAGC
GACCCGCGCAACTCTCGTTTAATTGTGCACCGTCCGTCGTTGCATCTCCGATCATCCAGCACACCTCGCAGCATGGGCGTCGTCCAAGGTGCGTCGTTAC
CGCTAGCGCCTGATGCTATGCGAACGATGAAGCAGGCTCGACTCACGAAGAACGCTTCTAGCCCCTCCATTGGAGCCGCCGGTTTGCCCAAAAGCGGAAC
GTGGGAGCAGCAGGATGGGTTTGATGGGCTTGTGCCTCTCTATGCTTCTTCAGGCAATCAGTATGATCGTCACATCTACGAGTTGATTCAGCAAAGTCTC
GTACGAGCATTCAGCAGCGTATTCCAGCAGTTTGTCGTGGATTCACAAGCAAAGGATGCTGCACGGGGTGAGGATCTCTCAGTCGGTAGCAGCTATGAGA
TGCACTATGTTCCCCAGAAAAGCGCACTCCAACTTGCATGCAATGGTTTCGTGCTGTGTGCAGCAGTGGCATCTCATTTGGCGTTGGTGGAGCACTGCAA
TTCTCTGTTTATCCGCCTTTGCAAGTACACGGCGCTGCTTTCATCAGACATTTATCCTGTGGGATACAACGGCCGCGAAAATGGCATCTGGGTGTATTGT
GGCAACCAGAGTGCTCCAGTCGCGACTGCGGCTGTACTTAAGCTCGtcagcacgtgcagcttgTCGCTACACAGCCGCTCGTGGAAGTACTTTTTCCACG
TCGTCAATGGTTTGCGTGAGTTCCACGTTTTGCCGTCTCGGATTCTGTATCCCAGCGACGAGATGAATCTGGAGTTAATGACGCCCGACGAGCGCCTTGA
GTTTATTGACCTAGTGTACCAGAACAAAGAAGAATTGGAAAGGAAGATTGCGCTTAGCGCGCAAGGCCAGGACGGtagtggtggagatgctggtggcTTT
TTCAGCGGTGTCGCGTGGCTGCTATCAGCTCTTGATTCCAACCTAGGCGGTTCAGCACCTGGATCTACCACTACGGCAAAATCTCATCTTTCTCCTGGGT
TTGAGCAGTACCAGCTTAGTCCGGCTGAGCTAGCTTCGCACACGGAAGACCTAGTGATCGAGGGAAATACGCCAAAGAAGCAGCCATCTGACGGTGAACA
CGACCCGCGAGGCGAATTCGGCACTGACCAGTGGATCCGAACCACGCTGCAACCTTACCGCCTCGAGTTTTTGATGCAAGACGTGGCAAGCTTGCCTTCT
CGTGCCTTGGCTGAAGTTATCGAGGCGCTGCATGACGAGATACTGCTGATACTGCGAGGTCCTGATGAAAAGGAGACGCAAAAAGACCGGAAAAAGTCTA
CGAAGCTGGTGCTCAGCCAAGGAGGCTGTGTTTTATTTGAGCACTTGTTGAGCCAAGTGATCTCTCTCAGTGGATATCTCTTTGATGGTGGtgcagatga
tgaagacgggATATCTGCTGTGCTCGAGGCTCACTACACCCAGATTTTGGAGTTTTTGCGGCCAGTATTGCTTACCAACCATAGTCCAAGTGGACTGACG
TACGAGAACTCGTGCTTCTTGTTGCACAAGTCAATCAACGGTTTGTTTGCTTGGGTGACGCGTACGCATAGTGACGCCAacgggctgctgctggtgaact
TCTTGGGTACTTTGATGGAAATGAGCGGTGATGAGGAGCTTATTCGTCCTTTCCTGACGCCAATTATGTGCGGATTGAATCGATATGTGACGTTGGTGCA
GCCGAGCAATCTGCGCTACACACGCATGGACTGGCTGACGATTTGTAACTTGATCAGCTGGTCGGTTGGGATGCCTCACGCAGCCTCGCACGGCTTCGGA
CTTCTTGAGCGGCTTGTGACGGAAAAGATCTGGAATGGAGACGGGAACGAAATCCTAATTAGCGACTGCTACACGAAGATGATTATGTTCGCCATGAAAC
CCCGCGACCCGCACGATTCATGGGCACCCTCGAGGCCAATTGATCTACTTCTTTTCATGTTCGATACCCTCCGCCCTGATGCGCCCAACTATGTTGATGa
acgcttgcgcttcttgggcgGGATGGCTGTTATATCGAAGCATCTGCTATTGAACCAGGTCAAGCAGGAGATTTCCAACGACCTCGTTGTGGTGGCGATT
GAAGGATTGAAGCACATGCTACGCGAACACACAGGGACCGAGCAATCATTTAACCCCATGGCTTGGCTGGACGTTCTTCGATACGGATTGGTTCCTGTCG
GTTTTGACTTGCTCAACGATGCTAGCCCCAAGCATTCCGGTGGAGCAATGCATtttggagacgacgaagaggagacaAATTCACCCTTCCTGTACTACCG
GCGGCAATTGCCTTTTATGGATGACGAGAGCTCGTTGCGGAACCCGAAGGATGTGCACGTGCACAGCGATACTACGGGCCCCACTGGGCGTCGCCGGCGA
CCATCGACTATGAAAGATCCGTTAGCACTACGACCGCATGTGGTAGTGGTTCAGTTGCTATCGCTTGTGGTGTGTGAAGAGTTGACAAAGCTACAGACAT
GCGCCAAGTTTCTGTCCGTGTGGGAGAACGTggcagagctgctggtgggaTTGCTGGAATACACAGTTATGGAAAATCCTCCATCCCCTACGAATGGAGC
CGCGAGTGGGGAGGTTCTGATTGCAGCGTTAGAGCGCCGAAGTGTGCTCTCAGCCCACGAGGAGATTCTTGAACACAGTAAGGGAATTGTCAGGCGTTTA
GCTGTGCTGCAAGACGAGATcaaagagcaggaggagacagaagagcaagaggagACAaaagagcaggaggaagccaAATTGGTGAGGACTCGGCAGCCCA
ATGCCTTgatgcaggtgctggaagagaaaTGCTGCTCGAACCCGGCCTTACTGGAGCAGCTTTTCTCTTCGAAGGACGACACTGGGTCGACGGGTGGACG
CACTCCTCCTATCGaagaagtggatggagagaATTCCGAAGAGCAAAACGACAGTGATGAGGCGAGCTAAACTGACGCAACTACGGCTCGTGGAAGGTAG
AGGCTTATATTTGTTCATAGAAGTATGCAAATACTGGTGGGGTTGGCTTATAGCTAGTTGTTTGCTGTCTTGTCGTTAGCTGATGGGTCTAACGGCTGCG
TTGCCGCTCTCTGACGTTGGTCCGTGCGCATCCAACAGACTCACAGCCTCGTCAGCCTTCGAGTAAACCGTCTGAAGCCTCTCGGAGAAGCATTGTGTGA
ACGTCTGCGTCAGCTTGTTGATGATCACGTCCTTGAGATTGGCATCGTTCTGCTCCACGGCGATGTCGCACAGTCGTTCGGTGATGTCGACAAGCAGTCT
TACCTGTTTGAGGGAtaacaacagcagcaacacgtcaGTTTGTGGGGCACAGCACCCTATCCAGGACTTATCAACGTACCTGCTCGCTGACGCGCGACAC
ATTCTCTTCCAGCCGTTTCGCCCCAGGGTTCTGCACTGCATTCCCGCTCCGTACTCCGGATAGAGCCTCCGCCTTCCGGACGATTTCAGCCGTGTCGTTT
TCCTCcgggcgctgctgctgcttgccggCATTCGCTCCTACACCCGCACGCTTCTCCAACACCTCGAGAGCCTCTTTGACGTGGCCCTGGACGAGAGCAA
TCTGCTGGACGTTCTCAGTGCAGTTCGCGTTGACATGCGTCATGATGTGGTCGAGGCACTTGTGGGCGTtttccagctccaccgcGAGTTTCTGCGTCTC
CGCCTTCGCCGCCAGCCTCTTCTTGTTCGAGTCTTCGATCTCGCGTTTGGCCGCAGCGAGTTCCTTCGCCCGCTGTTGCACCTTCTCGGACTCTTGGACA
GTAGCGAGCGCGTACTTCAACGAGGCGACTTCGTCCGTGAGACTTTGGATGGTGGCAGCGCTCTGAGAAGTCTTCTCGTCGCCCTCCTCGCGAAGTTgct
tcgcctgctgctcATTGTCGACATTGCGCTGGTTGACCTCCATGCGCAACCGGTTGACTTCTTTCTGGAGCTCGCTTCTCGACTCAAGCAGACTTGTCTT
CTCACTGACCAGCGACTGCACGagcgccttcgccttctggCGCTTGTCCGTGTTTTCCTTGTTGATGGCCTCGATGGACGTCGTCAGTTCTTGATTCTTC
TTCTCAAGCTGAGCACATCGTGTCTGCAGGTCCTTGAGAGTCTCTTCCGCTTTCTGGTAGTCGGCGTGGACCGACTCGGAGCGCTGCCGGTGCTCCGTGC
TGTCAGATTTGAGCGTGCTGTGTTGTGCCTGAAGCTCGACCATTTCCATGCTccacgtcttcatctccgccttcagcgtcgtcatttcgatctccttctc
cgatATCTTCTCGTTGAGCTTGAGGTTCTGCTTCATCATATCGTCTAGGCGCTCCTGAGAGGCCAAGTACTGTTGTTTGATGGTTTGCATCTCGCCCAGC
TGAGACTGCGTCTCGGCGATCAAACTATCGCTGCGACTTCTCCCGAGATTGACCTTCTCGTACAGTTGAGCAATCTCTGCAAGcttctcttccagctccg
agCATTTGCCACACGAATACGACGCCAGTTCGTCACACTTGGACTGCAGTTGATTTTGAAGCGAGGAGATCtcagcttgcgcttgaagcACCTTCGACTC
ACTGTCATCCGCTCTCCGCCGGTCACTgtccagctgctccaacTGGAAGTCCTTGTCTgagagctgcttctggaGATGCTGGTTTTCAATCTTGTGTTGC
TCAAGTTGGAATTCTAACTGCTTAATCTTCTCCAAGTCGGCTTCGACGAGATTGCTCTCCTCAGCCTTGATTTGCGATTGCTGGGAGCTGAGCTCTGTTG
CAAGAAAGCTCTCGCGAGCTTTCAGCGAGTCAACTTCCTCTTGCAGTCGactacgctgctgctcagcggAGACACGCAAGGCTTCCagttcgtgctggag
actCGTGACTTGCTGAGCCGATCGCGAAGCCTCAGCTTCCACGCTGCGTAGACGCTCACGCAAATCTGCCATGTCGAAGTTGGCCGAGTTCAGCTGACTC
TGCAGAGCGTTAAACTCATCATCAGTGTGggagccagcagcaactggttGAGACAAGAAATCCATCTCTTTAGCCTGGTCTGCAGCGGCTTTTgcggctt
cagcagcagcgagctcttCAGTCTTTTGCTGTAGCTGCGTCTCGAAGTTGCGACTTTTCTTCCTTTCAGCTTCGAGCTGCGAGGTCACCGCGTCAGCGAA
AGACTTGGCGCGCGTCTTGAGATCATTCTCTCGCGCTTCGGTCTCTTTTTTCAGTTTCTCGATTTCCTCTGacaggtgctgctgctccgccaAAGACACC
AAGCCGTTgtctgcagatgcagctgatgcagccgccgccgcagcggcagtcgcttccttcagcttctcctcgagGGCCGTGACCTTCTTCGTCTCATTCG
ATAGCTGGCTGCGCATATTGTCAACGAAcgccttggtcttggccTTGAGTGCATTGagcgcctcctccttggcgtGCACCTCACTCTTCAGTCGAGCAAC
TTCCGCTGCCGCATCCGGTGGTGCCACGGCTGTTGTCGGGTCCATCGCTTCTCACTCCTCTGCTCTTCCGCTTGGCTCGTGTGATGCAGAACTAACTGAC
TCGCGGCGGACAAAGAAGCAGCCCCGTCGTGAGCCACACGACAGAAATACACCGCGGACATGACAGTAATCTGATCCGAAAGAAGTGCGGCCTCATTTAG
CATCCAGCCATGATGCAGATCGTACTATAAGCGACTTCTATCCAtccctcctcctccccaTTTTTAGAGAGCTGCGTGGCGCAGACACCTTCCTCATCCT
CACCGTTGTAAGCCGTTTCACGCCTTCAAGCAGGAATGCAGGTGTTCACGTCGGAATGCAggttcaacttcaactatGAAGTCATTATGGCGAGGTAAGT
CATTATGCAGAGGTATTGTTACTCCCATGTTACTATTTACGAATACTACCTACCCGAAAAAGTACTATGGACGGGAGCAACGGGTCGCTCGTGGGCGACG
TGCACAGCAACGGAGGGGAcatcgactcgctgctgtcgaacaACTCGGACGTGAGGAAGGAGCCAGCGCGGCGTCTGCACGAGCCGTACGACCGCCATCG
CGCCCACGACCTGCGCGCAGAGTGCTATCGTCGCGGCATTCGACCCATAAAAAAGGGTCCGAATGCGAACGACAACAAAAGTGGGTACATTGAATTATTA
CGCAAAAATAACGGTACCCTTTCCAAAGCACAAAGTACCCAAATATCCAAacgagcagatgaagagactgaagacgaagaagacgccagcAATGCCGGAG
ATAACGTTAATGAAGTCCAGATCATCACCAATATGACTAACAAGAGGAAACTACCGACGATGGCCATGCAGACTCAGACTCAGACGGAGACAAGCAACtt
aacttcaacttcagcagcagcagcagagttgCAGGGATTCTATGAAGGAGGTCAGCCAAATCTCGTGTCGGTGTTGCCGATGCAGTATCCGCCCAATTTG
GGGAAAGCTTCGGCCAATCCGACGACAGATTTGGAGATTCTCAGTGGGATCGCCAATTCCTACACGCAGAACGTGGCGGCCGATGGACAATTGTGTGGCA
ATTGTAGAACGGTCGTCACGGATCAGTTGATGGAGTCCATTCGACTGGGGAAGACCAAAatgcagctgcacgagtgGCACAAGCTGACGGAGCAACGGGA
TCGGGATACGCACCACTTGAAAGAGGTGATGGAGATTTTACACGGGTTACGGAAATCATTTCGAGAGGCGCAGGTTCATGGCATGAACCATGACTTGCTG
GTAGAGCTGCAGGATGACATGGCGTTTTTCCAGAACCTGAAGGAACAGACCAAGGAGAGGATGCGGCAGGCCATGCGGGAAGCACGAGAACGCTCAGCGA
ACAAGTCGAACGGCACGGCATAACTAAGTGCTATAGTTTCAACAGGCAGAGCTTAACTTGTACTTCTCGTTAGATCTACCTACCGACGCGTTGTCGAATG
CAGCCTACCGATGGCTAGAGAAGGTGCCGATTGTTGGCTAGAAAGTGTGACGTCATGGCGGCGATGGCAGCTTGAAGCGCGCGGAGATGAACAATCAAGC
GAAGACTGACTATACTGTTTGGTGGCGACATCTCCGTTCGATGCCCGATCGGAGCTTTGCTTGGTTGGACTAACCAATATGGAGCAGGAAAGACAATACC
GATTTTtaactggagcagcttgtacacGAGATGGATCTGATAACAGCACATCAGTACGTACGAACTCTGCTGCATTATCTGCTCACGCCTGTAAGTATAT
ATGATGGTCGCGCGTCCGTGGCGTACTTGTGAGACTAACTGCTCGTTGCGCTTAAATATGTCAACCACGTTGTCAATTCCAGAGAGCAAAGCGTGTAGCT
GTCATTTGCGAATCTGCAACCTTCGCGCACaagctaccggtagctcCGCCGTTTTCCAAACACACGCAGCTACGCCCCGAGTTCTTGACGTCATGATCGC
GCACATCGAAGTGACTACTCCGACGTACAATCCTGCTGAGTCGCCGCCGCACCGAGAATCGACTGCGTTGGGACTGCCGGAACATCCTCCAAGATTGTCT
ACGTTCTCGCACCTCGACCTCAATGACTCCGGCGGTAGCAAACACGCTACCGGGTGCTCGGTGGCCATGCTCGTGCTTCTTTCCCTGCCGCGAATGGCTA
CCAATATGGCTTGGTCGGCGCAGTGGGCCGCCCTCGGCCCGTACCTCGGTACAATGCTGCCGCCGTTTGCtgtgcagctcacgcagctgATCGGTCCGCT
ATCAGGCATCCTCGTGGCACCGACAATCGGTGTCCTCAGCGATCGCAGCACATGCAAGTGGGGCCGTCGCCGTCCGTTCTTGATTTATGGAGCTGTAACA
AGTGCAGCGTGCTGGATGTTGATGGGATACACACGAGAGTTGGGGGAGCTGCTTGGGGACTCAGGGGACAATCGTCCATGGACTGCTTGGCTTACGATCC
TGTTTTACACGTGGATGGATGTCACTGTCAACGTGGTGCAAACACCCGCTTTCCTCATCATCGCGGATTTCGCAGGCGACCGACAGACCTTGGGGGCAAG
CATCGGGCAGGCCAGCTCGACGTTGGGATCCATCTGCGTAGCTGGCTACATTTACATCTTCGGTGCAGCCCATCTAACGCTGCGTTGGTTCCTCGGCATG
CTCTCGGTGACCATGTTGGCTTCTGTGGGTGCTGTGTGCGTGTTTGCCAAGGAGGAGATACCAGTCTCTAAGGACTTGGAATCGGTACCAGGCGAGGAAG
CTCCTAACACAATGAAGCGGATTGGCGAAGCATTCTCCTGCATCTTTCACGGCTTGAAGATGCTTCCTCGCACCCTGACAATTTTCTGCCTCGTATTCTT
CTGCATCCAGTTTGGTTTTACAGCTTACAATGGCAACAAGGGTCAGTTCTTCGGCATCGAGGTCTTCGGAGGTAACTCAACGGAAGCGGACGTTTGCGGT
CCAAGTCACTGCACGAGAGACCAGGAGCTCTACAACGACGGCGTTCAGATTGCTGGCGGTCTAGCGGACTTGCTTTTCAATGTGCTCGGATACGTGTATT
CGTGGGTGCTACCGTTCATGGTTTATCGTCTGGGTGCACGCTGGGTCATCACCGTTGCGTGCGTCCCGCAGGCGCTGTTGATGGTCATGGCGTTCACAAA
AGTTGTTgccgtggacgtggtgaTTGTCGTCCTGACTGCCATTACGCAGGCCACGGTTTTCGCGCTCATCGTGCCTATCATCGTGCATACCTTCGGCACT
TCCGCGCAGGTTGGCATGTATGTTGGCGCAGTGAACTCCGCCAATTGTGTGGGCCAGCTGCTCAATTTCTtggttggtgctgcacttgtGGAGACGTCGC
TTGGATACGCGTTGCCAGTGTTTGTGGGAGGCGCACTCTCGTTCTTGGGCGCATTGATCAGCCTCGGAGCGCTACGGATTGACATGCACTCCATGTAGTC
ATGAGACTGGTACAGTAGGATGTACGTGCTGATGAAGTCTCATTGTTACTTTCCTTAACCAATTCAATTGTTTGACCACTATCTTGTCGTTCGCTTCAGT
AATTCGACATGTTTCGTCGGCCCGTGTACCCCAATGTTGTCCCATGACTGAGTGACGCAACAAAGAAGCGTTAGACTAACTAACCTCCATGCCCACCAGC
CCAAGACACACGTATCTACGCACAAGTTCTCAGCTAGCAGCGTCTTGGATGCGGCGTTTGTGTAGCTCTCCGATAGATGGCGCTCAGGAGGTCTGTATAG
GCACAATGAGTACATGGATTAGAGGCTTCGTTTTATGACGTGTTCACCATAGTAAAACTCACGAAAGCATTCCGCTGAGATCCTCAGCTGCAACAAGCTT
GCCAATTCCCGCAAGCAAGGAGCGACGCGAGTCAATACGACGACCAGAAAGAGAtccactgctgccacttccacTTAGCGATGGTGATGCATGGCCATCT
TCCCACCCAGATGAAGGAGACTGAGCGCGTGCAGAGTTTTGACGGGATCCATGTCCTTGCTCATACTGATCAGAGCCACATGATAGTCATTGTGTCAGCA
CATACAGTATCGTTTCCGTGTGAAAGGCTGGTAATGGCTTGTAAGCTTACCATCGGCGTCACGTGGCGTTTGTGCTGCGAATTTTGCCGCGTTCCAAGTG
CAAAATTGTCCTTAGCCGTAGCTTCCATAGACGTTTGCGACGCATACGACCTACAAACAGGAGCACGTAGAGAACAATGGTATGAATATCAAAGATTGAC
ATCGTTGCATCCACTTAGTAGCGATAGCCACCTACGTCTTCCAGTCACTGCAACTGACATTATTCCCAGGCCCAACCTGATGATGACAAGGACAAATGCA
GATTAGCTTACAGTTCACGAAGTACGTCGATTAGATGACCAGAAGTTGCAACTTTTACCTGGTAAACAGCACTTTGGAAGGGAATACCAGGCACTTGCTC
GCCCGACGGATTCTGCTGAGGCTCAAATAGTTTCTTTCCCGATATCGCAGAGTTTTCGGCCACGTCGCGGGGCATGATGCCCCCTTTCTTATCATACGTT
AAATTCTACACAGAGTATGTTCATGTCAGTGGTTGCAGTGGCATAAAAGATTATTGGGCTGGAAATTTGTACTTACATCTTTAACACCGGATTGAGTCGT
GTAGAAGCGCTTCTTGTACGAACGACGCACGTAGCCTCCCCAGTCAGCGTCGGGGTGATCAGGATCGTACTTGTCCGACACATGCGGAATCACTTGCTGA
TTATTCGAACCATCCTCGCCGCCATgagctcgtgctccagcatcgAAGCGCGTCATttcagcttgcgcttgaaggTAGCTTCTCTCCATGAtctcgttca
gcttctgATGCAGCAAGTAGCAAGCCTAAATTCAGCCAGTTCGAGAAGGTTGGGCAGTTTCTCGTCGGCGACTAATTCCTTCGAGCTGTTCCGAAACAAG
ATTcatgtgctgctggacttcacTCGAAAACAGTTGGAATGACGTTCTCATCGATTCCATGACACCGCTCAGCGTCTCGACGCGTTGGATGACGGACGTG
ACTCGCTCATTGTAGTCTACGCGACGAAGTTTTGACGTTCGGGTAGTGTTGGCTGGTTCGTCTTCTTGACAATTTTCATTGATAGGTCGACCTTCGCTCA
GATTGACAGCACCTGGTGCAGAAGATTTGGTCTTCCACTCCATCGAAGGAAGCTTATACTTGTCCTGAATTGTCGTAGGGACAGTCCGACACCGTTCCAC
TTGACGCCTCTCAGCATCGCCAAAACTGGCCGAATCTTCGCTCATTTTGCTATCACTTTCGCTCTCATTGTGCTCGCTTGCGTTGCTTCCAGACTCCAAG
GAGGATTCAACGGCCTCAACCGATGTCTTCGTCAGCAGGCCGACAATTTGTAGCCGGTTGTCGACTACAACCAACGAGATCGGGTATCGAGCGCTGTGGT
CTAGTGTTGAATCCGACAGAGCTTTGGCGATAAGTCTCGAAAAGTCAGTGGAGCTTGATAGCACAACGATTCCTTTGATGGCTGTGGTTTGAGTCTGCAG
CTAAGAATGAGCAACAATTGGTCGGTCGCTCACAAACACAGCAAACTACAGTGCTAGCAACGAGACGAATCTAAAGACTCACCGCAAATGCCGGGAAATC
AAGAGAGTCTCTCACCGACGGCCAAATCATGCGGTACCGCTTGGACTTTTCTTCTCCAGCCTCCGCAATCTTTATCCGCCAAGTTCGCCAACGCATTTCT
GAGATTATGCAAAACTCAAACCAATTATCATCCAACGAGTTAGGCCCAGCAAACTTCATCGGCTCCGAAATGTTTCGGACGGCGTCATGTGTGCCCGACG
CTAAGCCTGGGTACATCTGGTGTTTTAAAACAAACCAGGGCAACACGATTAGAAATCGATCAGCGTCTAGATACACCCATACGACAAACCTGAGTCATCG
TTAGCTCGACAGTGGAGCTTGCTTCGTCATTTCCTTGGACGAGTTTTAGCACCTACCAAttaaaaaaacacacacTTATGAGCCACCTCTACTCCTCAGA
TTTATCGAAGCAATTGCGGCCACGTACACTCAACGACCCATCTTGTTTACCGGCAAGGATAAATTGCTTTTGCTGATCGCGACTACCGTAGATCCACCAA
CGAAGACTGGTATATGCACAGCCCGTGCCAGGCGTTGTTGATGAATGAACAAGTCGGACGTGCTCAAGTGGGTTGTCGCGCGTTATCACCCCGGAGCGAG
AGCACGGTCCAAGTTCCAGTCGCTTGCCTCCAACCACTTGTTGCAGTCTCGAAGACATGTTATATCCATCCCGCGGGAAGGCTATGAAATCAATCAGCGA
TAGTCGTCCTTCAGCACCCCCAACTACAAGATACTGGCCATCGAGGCTGCATTCAGCAACTACCACCCTTTCCGattgctgcttcaactgAGCCAAACAT
ATCTGCCGATCACTAAACCGCTCTCTCCAGCTAAACACCCCAAACATCGTTGAATCTTCGAAGAGAACAACGACAGATCCTGAATTGGGTGTCATCTCAC
GTCGACAACTCTGCAAACAGCGGATACTCCTCCGCACAGAAGCCCCCACAAGGGGTTCCACGAAACTGAAGTGAACTAGAACgggtgctggagcttgacG
AGGCTTGTCGCCATCCACAACACCGACAAATTGAGACACAGAACCTGCGTACAGCCGGAACCCAAGTAGAAAAATCGTTTTGGACGGGTCAACCGTAGCA
GCATTTCCCGAAATTTCGGATTCCGGAACTTCCACGAAAGCTCCGACCAACAGAAAACCAGGGACGGGGAACGCCACACACGTAGCCATCACAATATCTA
AGTCGTgatcgccatcgccgtcatTATTTGTGCTATGTACGTGAGTTGCATGGTCTCTGATGGAAATTTGTTGGAGGAACGTGAATGGATGTAAACAATT
GTTACCGACGCCGTACAGATCGACGAAGCGACCGTTTGCGATCGCAACCACGCGGGTCTTATAACAGGCTGCGATGCATTGATTGTCACCATCTTGGAAC
CGAGATCCGATGCGTGTAGGAGCCTCCACAGACACGTCAACGTCCAGTACGTGAAGCCGATTCGACATGAAACTGTATACAGGGAACAAAAGTGTATAGT
TTACAAGAAAAGTTTTGACCAATCCAATCGATAGAATAAAAGTTTTAGTTTTAGCGAATCAAAATATGCGATGTGTTTTGACGAATCAGAGTCGGCTTTT
GCTGACCAGTCAGTTCACTTCCAAACATCAAGTGAAaaccaagctgctggctgccaGTAGCCTCCCCCCTCGTTCAGTGTCGATTTTACCTCCGTAGACG
AGAATCTCTTTTAGATTGGAGCTCCCGGTGCGCGCTTTGTgtgtgttgttgttgtgctttTGTATTGTATTTGTACTTTTGTAGCGTTCGAACGCTGGCG
ATGGAGTGAAGATACCTAATTCGTTAATTAGCGAAAGGAGCGAGGACCGTTTTGGtctctcctccttctgtGAGCATTACACTTTGTCATAGTTACACTG
ACC