Description :
From Genome Similarity Track
Location :
Scaffold_264:27119- 29586
Transcript NameFunction/comments
Phyag_g4091oligopeptidase A, putative

Sequence
2467 bases(100 bases per row)
GAGGCCGTACTGcgcgagcagcggcaccatGGACGGTTTGCGACCGCGGAACTCCTCGAAGACCTGCTCCGGGTgctggccgccgccgcgcgctAGGATC
GTGTTCCGGAACTTGCGGCCAACACGCGCCGCGGTCTCGGGACTCTCCTTGGCCGCCTCCTCGAAGGCGCCGTAGGCATCGCACGACAAGATCTCGGCCC
ACTTGTAGCTGTAGTAGCCTGCAGCGTAGCCGCCCGCGAAAATGTGCGCGAACGAGCACAGGAATctgtcctcctccagcggACTCAGCACGGCGTATTC
GCCCAacaggcgctgctgcgccgcgaACAGCGGCTCCTGCGACGGCGAGTAGTGCGAGTGCAGATACATGTCCAAGGCTCCGAAACCCAGCTGACGCAAC
ATGCCTGTGGCCACCATGTAGTTGCGGGCCGCCTTTAgcttctcgaacagctcgtccggCAGTGGCTCGCCCGTCTTGTAGTGCCCGCTGATGGCAGCGA
TCGTGTCTGAACATTAACGTAGCAACACAATAACGATGTCAGATATATGTCCACTAGCATCGTGCACCTCCATACGAACCTTTATCGTAGCAGAAGTTCT
CCATCATCTGCGATGGGATCTCGACGGCGTCCCATTCGATGCCGTTAATGCCAGCCACGTCACCGTACTCCATCTGCGTGAGCATGTGTTGCAGACCGTG
GCCGAACTCGTGGAAGatcgtctccacctcgcggAAGGTCATGAGGCTCGGCGTCTCGCCCACAGGTGGCGACTGGTTGCAGATGATGTAGGCAACCGGA
ATGCGCTTTCCATCCTGCTCCTTGGGGCCAAGCAAGCGGCTACGATCCACACACGTGTTCATCCAAGCACCACCGTTCTTCTCCTTTGGGCGCGAGTACG
GGTCCAGGAAGAATCGCGCGATCACCTCCTTGTCGCCTTCAGTACTGCGCACATTGAAGAAGCGCACGTCCGAATTCCACACCTCAGCTTGGCCGTCCGC
CGCTTCGATGGTCACGCCAAACAAACGGGATGTGAGCGAGAACAAACCGTCGAGGACCTGTGCATCAGTAGCAACATGAATCAATATGAGTTATCCTCAG
CTACATCCAACAAATTTTCAATGGGTCACAGCGTACGCGTTCGAGTGGGAAGTACGGCTTGATCTCTTCATCGGTGAACAAATACTTTTCCGCCTTGAGC
TTTTCCGACCTGCGGGTGAGTTTGCCAACAGGTTAGAatcagaaaaaaaaaaacgaTAGCAACCTACGCATATCATAGTGTACGCACCAGTAACCAAGAT
CCCATGGCGCCAGGGGTTCCGTCTGTCCGTGCTGCTTCGCGAATTCGGCCACTGTTTCCACTTCCTCATGGGCGATCGCGACACACTTTTCGCGCAGATC
GGTGTGCATCTTCTCAACTTCCTCTATGCTCGGAGCCATTTTTTTCGAGATGCTCACCTCGGCAAACGAGTTAAATCCAAGCAACTGGGCAATCTGCTGC
CGAATCTCGAGCAACTCCACAATGATACCCTCGTTATCAAAAGACTCGCCGCTTGCGCGGGTCGCGTATGCACGGTACAGCGTTTCACGCAGAGAACGGT
TTGCCGAGTATTTCATGAACTGCACGTACGACGGCGGATCCAGCGTCACACGCCACGGACCGTTCTCAGGCGAGGCATCGGAGTGGCCGTCATCGCGAGC
GCTTTGCGCAAACATTTGCAGCAACGACGGAGGCAATCCCTCCAGCTCATTTTTGTCGGTCACTGTGATCGAATACGCCTtggtggcgtccagcagattC
GACGAGAACTTGGTGCTCTGTACAACAAATTACATCAGTATCCTCCTAAACAAATAAAAAATAACACCCCAATCCTCTTTCGTACCAACTCGGCAGCACg
caacttgagcttgttgaacttctccttctcctcgcccTCCAGTCCGACGCCACTGAGTGTCGCGCTTCGCAGACTGAGTTCAATGATACGTTGCTGCGCC
AGCTCGAGCTTGCTCCACTCCTCGCTCTCGCGCACTGCAACATACGCGTCGTAGAGCGTCTTGTTCTGCGAGGCCTCGGTGACTGTCTGGATcaccagct
gctgcagcttgtcgtgCACAgcgcgcagctcctccgAGTTGCGCACACTCATGAGGTGGCCCACAATGCCCCACATGCGGCCCAGCGCATCGCCCTGCAC
CTCCAGCGGGTCCACCACATCTCCGAATTGCACGTCCTTGCCGGCATCTTTTagcttcttcaccaacgcGTGCAGGTCGCGCGTGAAGTCGGCGGCAGCA
TTGGTGACCGCCGGCTCGATCTCcgacagctgcagacgctcgaagGGCGGCAGCTGGCGCTCACGCACGCACGCTTCGAGCGAGTTGGCCGACGCAGACG
CAAAGCTGCGCCAGAATAACGAGGTGCGGCGAGAGGTGGCGGTCGTGGACGCCGTGCGCAGACAGCG