Description :
From Genome Similarity Track
Location :
Scaffold_2:271110- 275250
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001075Similar to truA: tRNA pseudouridine synthase A (Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E))
Pytul_DAOMBR144PYU1_G001074related to a-glycosyltransferase
Pytul_DAOMBR144PYU1_G001073Similar to ubc4: Ubiquitin-conjugating enzyme E2 4 (Schizosaccharomyces pombe)

Sequence
4140 bases(100 bases per row)
GCTGGCGCTACTGCCTCCACATCGCGTACCTGGGCACAGGCTTTGTGGGCTGGCAGCGCCAGAACGAGAAGAGCTCTTTCGGCATGGGCAGCGTGCAGGA
GCTCGTGGAGGACGCGATCACGGAGATCCTGCAGGCGAAGGAGAGAGTCAACGTCACGAGCGTCAGTCGCACAGATGCAGGCACGCACGCACTATACGTG
AGTAGCATGTGCTGTTGGGTGTTGGCTGACTGTGAAAATGACGCGACACCATTATTTTCGTGCATGTAGCAATACGGAACCATTCGATTGGCGTTGGAGC
TGCCCATGTCATTGGAAGAGTTCAAGGACCGCGTCAACGCCAAGTAGGAGCTGCGGTTTATTTACATTCTTGAGTTTATCTGCAGCTGAGAAGACTGCTG
TGATGCTTTTGACGCTAGGTTGACGGACAATGTGGTCGTGCACCAAGTCTCGGAACTGAATGCGGTCACAAAGCCGACGCGCATTCGGTCACGCTACAAG
AAGTACATTTACTACATCCAGCAAGGCCATCGTCCAGACCTTGAACTGGGCAAGTACTCGTGGTTTATCGGCAAGAAAGTTGACCCGCAGCGTCTTCGCG
ATGCCCTCAGGTACGTCTGCTTATTGCAGGTGACCAATTGCTGCCATCAATATGCAATCTCATTCGTTTTGTATGCCTTGGATAGCTACCTGGTTGGTGA
TCACGACTTTCGTCCATTCTCACAGGGACTCCAGAAGGCCGAATTTGCAGACAAGACCACGATTCGAACGCTCATTTCGGCGAAAGTACGGGTACGAAGA
CACGTGAATTTCTCGCTCGACCCGGCGTTGTGTGGCATGGGAGAGCTCATGGATGAAACCGAGCACCTCACGCTCCCGGACGCGTTCACCAAGTTGCCTC
CGAGCACCAATGCTGCTGTTGCTGAGGCGAACGAGAAGAAGAAACGCAGGGTGGAGAGACCGTCTACCCCTGTGCATTTCATCTGCGTTGAGCTGATTGC
AAACGGGTTCTTGAGACACATGGTGCGCCGCATCATGGGCACGCTGCGCCCCATCGGCGAAGGCACATACCCACCACTCCGAATGAAGCAGGTCCTAAAT
GGCGAGATTGAGCCCGGTCCATCGGCGCCAACTAAGGGGCTCTGGTTGCATCGCACGTGGCTGACGCAAGAAGACTGGGATGCAGATGAGACGCGTGATG
ACTAATAGAAACGACGAGATTTCTTATTCAATTTTGCGCCGAAAGCGCATGTGCAGCGAACAACCATAGACAAACAAATCAAACAAAATAAAACTCTATA
GCTCGTCGTGGTCTTCCGAATTGTCGGTTTCTTGCTCTTGACGTCGCGCGACTTCTTTCAAGATCCGATGAATGTGGCCCAGAATGAGGTCGCCGATGAT
ATCTGGGGCATACTTGGCGATCATGTCCTGACGAGCTCGTTTGCCTTTCGCGATCGCTTCCTGTAAAGCGCAGATTGCATTGAAATTTTGCATGAGAGAC
ATTGAAATGAGTACAGCAATCGATGCCAAAAATTGAAAAAAATGCGCACCTCTGGGTGCTGTTTCACGTGGACCAAGAGCTCCTTGAGATGGTCGATGGA
CGGTTCTGCCCACTTGTGGCCACTAAAAGCTCCTTCGGTGATCTACAAAGTGCAACGCAACACATATCCGTCAACGCTCGTACTAATGACTGTGAATGCT
GACCTTCATACCTCAACGAGCCCGTCGATCCTCAGCCGGTATGAGTTTTCCTCCGTCATATACTCCGTCGTACCGCTCCAAAACGTCGCAATCACAGGGA
GTTCCATGGCCATGGCTTCCACATGTGGACGCCCCCAGCCTTCCCCTCGTGATGGAAGCACGAATGCTGTGGCTGCTTTGTACAGCGACGGCAGTGCTGT
TTGCGGAAGATGCGGCGGGAGAACATGCAACTTGGGCAGCTTCTTTAGGGTTTTGCCTACCGCTTCTCGCGCGAACACATCGATGATCTCCAGGAAATCC
TTGGCAGTTTCCGACTGGACGTGGTACGCGTTCGTTAACAGCACCAACACGACGTCGTCTTCTGGTGCAAATGCTTCAAAATAGGCTTTAATAAGCACGC
GCCACGCCTTCCGCTCCTCCCACTTGAAGATCGAGAGGTACACGGTAGTGTGCTCCGTCATGGTAAAGCCCGTCTCAGCTAGCTCGCTCGCGAGGTCGTA
GGGTGTCTCCACTTGTTCCGGATTGAAAAAGTCCACGTCCACGGCCTCTGGGACGACTTTGATGGCCTCTGCGCGCACGCGGCCCTCAATAAACACATGC
TCCTGAAACCTACAGCACCAGGACTCGTTCCATTATTGAGTGTTTTTGGCATTATGCATTGCGAAATACAACGTACCTCGTGGGCACCCAGATCTCGTCC
ATGTTGTTCATGCGCTCCGGCCATCCGCTGGGGACGCGATCGGTCTCAAACATCGTTCTCCCCACCTTGTAGAGCGCTCCTTTTGGCGGGCATCGGGACG
TCGTGTACCGCGCTGGATGCCACGCGCCAGGCTCCGAGTGGCAGATCGCGATCGCAATCTTGCGGTCGCTCAGCCGCCAGTTGAAGTCGCGCTCTTCGAT
CCAGTGCTGGAAATGAGACACAAATGCATACACACGAGTCAGTGCGTCCTCCATCCACTCCATCCTGAAGATCTCATACATACGAAACAGCCACGAGAGA
GGCGGAAGCAGCAAAGATACCTCTTTGAGCAGTTCATGCATAGAGTCCGGGATGTCGCGGATGAACGCCGCGTTCAGCGAGTCGCCGTGTTGCGTGACCA
GCAGTGAGAACGGCGTCACATACTTGGTGCTCGATACCGCAGCCTGGCTTCCTTTGCTGGAACCTTCATGGGAATGTGGCGGAGTGTTAATGGTGGAGCC
GTCTTGCTCATCAACAGCGGCCTCTTCCATCGAGCGAAGCGCCGCGGCGATCGACGTCACGTACGAATGCGCCTCGCTGCAGTATCCACCGCCGCTCAGG
AGCGGCGCGTACCAGATCACAGCCGGCGGAGGTGGAGGCGCGTCGCCTCTACAAACATCAGCAAAAGCAGCAGCGCAGAGTACCACAGCCACGTAGAGCA
GCGCGCGCAGCATCCGCATCTTCGGTGGAGAGCTCAATTGTCGAAATGCGATCTTGACACCCGCGCTTTTTATTGGGAGCTCTAATGTGAAGCCTTACAG
TGATTTATCTATATACAGTATGCGGGCGGCTTTTAATAAACATGTGACAATTGAGGACACATTTTTTAAAATTTTGCTGCATTCTTCCATGTTCATCGCA
TCGTTTATATAGCTGGGTGTGGCCCATTTTGGTTATGGTGCTGGCTCGAAGGCCTCACTCGAGTAATTAATCACGAAGCGTACTGCTTGGTCCACTCCTT
GGCCGTGTTGTCGAACTCCTCGCGGTTACTCTGCAGCTGCTTCGCGATCTCGGGCTCCAGCGGGTTGTCCACGTCCGGCTGCTCCAAGATCTGCTTGATG
GCCGTTAGGCAGTGCAACACGTTCAGCGTCGGGCCCCAGTTCTTCAAAATTAGATCAGACAGTTGAGTGAGTCATCGCCGTTTTACAGTGAAAGCCATCA
TGGACACGTACTTCGTTGATAATATCTGCGCAGATTTCGCCGCTTTGCGACTTCACGTTCGGGTGGTACACGCGCGTGAGGAAACGAACCTACAATACAA
TAGTATTTATCAGACTCCCATCCAGCTGCAGTCGTTATGCGCAATACTAAATGCCACTACAGTACTTACCCGTGGCGCCTTGAACGGATACTCGTTCGGG
AACTGCAGGTCGATGCTGAACACGCCGCCAGAGTACGGCGAGTTTTCCTATCATAAGCACGATAAGCAACCCCACTACCTCACACATACTGAGCTGCATC
CCATACAAATAAATACATAAATAAACGTACGGGACCGGCGAGCATGGCGTTCCAGTGCATCAGGTCGTCGTCGACGGCGCCAACGGTGCACCACTCGGGC
GAGTTCTTCTCGAACTCCGCAAGCTCCTGCATCACACAATACAATACGATAGAGATAGTAAGCCGCAGGCGCCTATACTGAAGCCAGGACACGCGCAGAT
GAGCAGGAACGCACTTTGGTCAGTCGTCTCGCCATCGCGC