Description :
From Genome Similarity Track
Location :
Scaffold_165:27110- 28113
Transcript NameFunction/comments
Phypl_g4548HECT E3 ubiquitin ligase, putative

Sequence
1003 bases(100 bases per row)
TGCAGGAGCACTTGAACATCGGCTTCATCGGTGAGCCAGCACTGGATGCTGGTGGAGTGCTGCGTGAGTGGTTCGGACTTGTATGCAAGGAACTTTTCAG
CGCTGAGCGTGGCCTTTTCGTGACGACACACGCGGAGGATTCCAGTTACTGGATCAACTCAGAGTCTGCCAAGTGTGGACCCGACGGGCAAGACCATCTG
CAGTATTTTACCTTCGCTGGAAGACTTTTGGGGAAAGCCATTTTGGACGGCCTTGTGCTTGAAGTGAGCTTGTCGCTCCCGCTGTTGAAACATCTCTTGG
GCGTCCCAATTACTTTCTCTGACCTGGAGTTTCTCGACGAGGAACTTTATAAACACTTATGCTGGGTGCGGGACAATGACCATGTGGACGCTTTGTGTGT
GACGTTCAGCATTCAGACGCCGTCGGGTGAGACGGTGGAGCTCAAACCTGGCGGAGAAAACATTGATGTGACCGACGATAACAAGACAGAGTATTTATCG
CTCGTTCTACAGTATCGCATGTTGGACAGCGTAGCTGACCAGCTCACAGCGCTGCTGAAGGGTCTATATGATGTCATTCCGAAGTCTTTGCTCACTATCT
TCGATTATCAAGAGCTGGACTTTTACCTCTCTGGACTTCCTACACTAAACGTGACGGATTGGCAAAACAACTCGCGCGTTCGACATGCAGCCCAGGATGA
CGATTCCGAAGGAATCGAGCAAGAGATTGAGGTGATTCAGTGGTTTTGGGACGTGGTCGGCTCTTTCACAGACGACCAGCGTGCTCGGTTACTGCAGTTT
GCAACAGGCTGCTCACGTGTACCCGTCGAGGGCTTTAAGGCACTCACGAGTGCAAGCGGCATTGTGCACTCGTTCACACTGCAGATGGTGCCTACAGGCA
CGCCCCCGCTTGGAATGTGTCCGCGCGCGCATACGTGCTTTAACCGCATTGATTTGCCTGTGTACGAGACCAAGGAGGATCTCAAATCGTATCTATCTCT
GGT