Description :
From Genome Similarity Track
Location :
Scaffold_8:271073- 273667
Transcript NameFunction/comments
Physo_129543hypothetical protein

Sequence
2594 bases(100 bases per row)
CCAAATAATGTTTTGGGTTATAATGAGAACTGCTATTCTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAAATAGGAATCTGCCAACGGCT
GGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGT
GGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTGTCTGTTAGAGTTACAAGTGACTG
TAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTC
TTCACGTTGGGAGAAAGAAAACTCGAGCTTATTCCGCAATGAGCTTGCCTCAGAAGAATACCGACACTGCAGCAGAGGGGAAGTCCTCCGCCGGGATAGA
GACTCTCTCTATCCCCGAGTACCGCGAGCGTCTCAAAGCAAAGCGTGACGCTCTTGCTACCAAGGCTGCGGCGGGGACAACTTAACCAGAGATTGCCCTC
GAAGGTTCTGCTGCAGTCGACGACGCCGTTGACTTCGACGACGACGTGGAGATGGAAGAGGGCGAGGCCTCTTCTAGCAAGCGCAAGGAGTCTATCGACA
GCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGCGACACTCC
GCTCTCTGCTGCTGGGGCTTTAAGCTCCCCACGTGATGTGGTGACTTCAAGTTCTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCCGTCTGCG
TCAGAGATCGCTGACCGCGTGGGCAACACTGTGCCTCCAAACGAAATTCCGCTGTACGTATGCAGCGGTATCCGCGACGATGCTGTTGCGGAGGCGCAGC
ACTTTGATCCGTTAACGAATCAAAGGCGCGATTATTACATCGGGCTCTTCCACGAGCTCTGGTACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGT
GCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCTTACCGCGAGCGGGTTAAGCATGCCCGTAAA
CGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCATGCGCTGTGCCCGAAGGCAATCAGTGCA
CGTTGTGTCTTCCGGGTGCGGTGCGCTTGAGCGACCGCGACCTAAACGGGTACACGACGATTCGTATACCTGAGAGTCTCAAGGATCTCCGTGCCAAGTT
CTTGGCACGCGAGGAACGCGACGATCGTGGGGCTTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTTCGT
ACGCCCTCACCATTTCCGGAATGTCCTGCAACAGGACGTCCTGCGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACGAATACGATAACGAAC
CGGCTGACGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGTGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGG
AACACGCCCCGGGTATGGTCAACCTGGGGTTGACCTTGGCCCGACGCTCGAGGAGCGGGTCGCTGCTGTGGAGCAGCTTCAGAGCCGTGAGTGCGCCGCT
CTGAAGCAGGAGATGGCGACCCTGAGAGCTCAAGTTGCTCAGGCCTCGCAGACCGCGTCGGACATCTCTGTCGACGTGGGAGGTCGCGTCGCACGCTTGG
CCCAGCGCGTTCACGCGCTGGAGCAGAGGTTCGCTTCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTCGTGCTGCCGGTATGGCTTCAGC
CGCCCGACGTAAAAGGTCGGATGGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACACCGTGAACGGCCCGATGAAGC
GCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTTTGAGTAGCTATCAAAACCAATGAACCCTTCTCGAATTCATTTGTGTT
GCCCCTGCCAACGTTGTCTGCGTTCATCTTCTGTCGATCAACAGAAGCTGCTGTAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAG
TTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCT
TCTTCTTTTTCTTGCTCTTGTCGGCGTCTGTGCCCGGCACAGACGCGTGCTGCTTGTTCTTCTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGCCAGC
GGCATTCTGCGGCTGCTGCGTTGCAGTCATAGATCCTCCCCCACTTAAGGAAGGAGTCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCATC