Description :
From Genome Similarity Track
Location :
Scaffold_950:271- 7318
Sequence
7047 bases(100 bases per row)
ATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGACCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGA
TCTGCTAGCGGGGCCCGCCAGGAACTGGTATCGGCAGTTAGGCAGATCCGCCAGGAACAAGCGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGT
GGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAACGTGGCCGGCCTAC
GGGCGAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAAACGTTGGGAGACGTGGATCTGGCCGACAGGCT
GACCCTGTTACGACTCCCCGACGCAGACGAGCTTGAGGAAGTGATGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGC
AAGTATCGCCAAAAGGCTCCGACGCCCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCTGACTCAGGAACTGAGTCAGGATCCGACGGTTCGG
ACTCCGACCCTGAAGATTACCGTCAAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACCGGAGACAACGCTCGACCGAGGGATACCGTACCCGG
GGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGAACAGCCCAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGG
AAACATATGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTGCTTCTACATGTGTCGCGGGTGTGGCGAGATTCATGACGTCGGCAAGT
GTCCGATGGAAAATTTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGAGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGA
CGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAG
ATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGTCAAAGATCTCGAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCGAAGTCTCTTCAA
CCCTGGATCTACAAAGGGGAGAGGCGCGCGGTTACTGGGAGAAACGACAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCGGATCCACC
TAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCA
GGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTACCGAGGTGTCTATACTAGATACCG
CCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGCATCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTATGAATGGGAGAACGCGGAT
CAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGACGGATTTCATCGTACCG
GCCGGAGTGAGGTTGGATCTAGTGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGACGACCGTTGTATGGGGCGAAGATGA
GGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAAACCTGGGAACTGCCAGATCGGTTAAGGTGGGTGGAACATGAGAAACTGTGGGTCAC
TCGGGGCGAGAAATGGGTGCCGACCGTAATCCAGGGACCAGGTCGATCACGATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCAT
TATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGG
TGTACGAGGCGACTACCGAGATCGAGTCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACACCGCG
AAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATACCGCAGGA
TCGGTGGACCAGGGACTGCAGAGGGCTGAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGATCCTAACTTTTCGTGGGGCAAAGTGTCTGGATCCT
TGTCGAGAGTGGCCGCACTAGCTAAACAGGAACCATCGTGGGTAAACCCTCCAGAGGATCAAGTCGATCCAAAAGGTGGCTCCCCCAGTACCAGGATACC
CGACCCCTCGAAGCCAGAAGGGATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCTAC
CGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCC
AAGTGGATCCAGGGACGAACGAACCCACTGAAGTGGATCGTCTACGTCAGAAGATCTGGGAAAGGCGACATCTGCTGATCGGTAAAGGTAATGCGCTACC
GCCCGCCGCCTGCGGAGTCAAATGTGACATCGATGTCGGTGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAGAAACTG
TCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGCTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGG
ATATACGTCTGTGCATTGATTACCGGCTGGTTAACAGCCTGACTCGATTGATGGTGTATCCGATGCCTCTGATCAATGAGCTGTTGGAAGATCTGGATAA
AGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTTCTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGC
CTGTTCGAGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGGTTCACCCGAGTACCGG
AGCCCGAAAAGGGTGGATCCGGGGAAGGCAATGCAGAAGTGGATCCATTCGAAGCGGGGGATCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAG
ATCTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTGTGTGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCT
ATCAGCGTGGTGAAGAGCTATTGGGGAATGCGCAAGGTGGATTACTTAGGCCATCAAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTT
CGTTAGCCGACTTGTCCTTCCCACAGTCGTTACCGGTGATGCAATCCTTCTTGGGCAGTTTGAATTACTACAGTCGATAATCGAGGATTACGCACTGTTT
GCTGCGGTACTATATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCGCTCCAGCTGTCCGGATCAAAATCCAACAGGCTCTGGCCCTGGAGATGTCGG
ATCCACGAAGGGATCCAAGTAGCACGACGTCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGAACCAACGGAGAGAGGATCCAGTCTGGATAGA
GACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTC
CGTCATTTCGATCCGGAACGTCGACCTACGGTGATAGTTTATGCCAGTGACTGGGCAATCTCAGCAGCTCTGGTACAAGAACATGTGGGGATATGTCATC
CAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTA
CAACCTGCTAGTGGGAAGATCCATCCGGATCCTCACTCGACACTCTACGCTAGCCTGGCTGTTTAAGTCGGCCGGGTTACAAGGGCGTTTGGGACAGTGG
GCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTA
AGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACAGTGACAGACAGGTGGATGAGGATCTG
TACGTCCTGTGTTTCGATGGATCCGCTCGCGTACGACGCGCAGGCGGGGCGTACAGTGTGATACTGTGGAGACTACCTGGATGGGTAGTAGTACGGGCCA
GATCCACTTACGCCGAAGGTTTCACCGTCAATGAAGCGGAGTATAACGGGCTACTGCTGATCTTGGATCTACTAAAGGGACAAGATCCGAAGAGGCTGGT
GATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCAC
CTGCGTGAGTGAATGAATCACGAGTTGCTGCATGTCAAGCGCGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTG
TCGAAGTGGAGAGAGAGACCGAGCGTCAGGATCTCGTTACATTGAACCGACTAGACGAAGTGGTGGTAGTGGAATCCGGGAAAAGGACAGTCCAGGTTAT
GGCGGTCACTAGGTCCAGAGGAAGGGTTGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTCCGCATTAAGCGGATCCTCAAAGCACAA
AACGAGGAAGCGTGGATCTTGGGACAAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTTGGGAGGATACCAAATCCTACAGTATTATCGCTACGG
ATTACGCAGTGGATCTGAATGACTTGCTCGTCTATTGCCCCCCTACGAAGAGTGTCAACGAGGACCGGGATGGATTGATGAGACTGGTGATGCCAGAAAC
CTTGCAACAGGATGTCCTACACCACTACCATGCTAGCCTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGG
AGAGGACTATTCAAGAGCGTACAACGATACGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATA
TCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATTT
GTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGC
GAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATC
GTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACAATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGACCAAAGGGATTGGGATGAGTA
CGCAGAGCGGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTG
GAAGCGGCCATCCCAGTTTGCAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGG
TGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGACGATGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTAA
TTTGGATCGAGTGAAAGAGGGGTATGCCCGCAAATTAGCCCACCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTG
GAAACGGTAAGTACCGAATACCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCAG
TGGATGTATCCGACCGCGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGACGAGTTCGAAGTCGAGAGGATCAC
CGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTGCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCA
GATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGCGTAGGGAGGGG
ACCAATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGGAGGGTGTGGGCCGGGAGGAGGGGGATCGCTGATGTGAGTTGGTCA
CATCAGAAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAGTGAATGGTTATGCTTTAGAGTGACGTTTTACGTGCGAGGAGTC
CTGTTTGATCTCAAGCACGAGCTTTCAAGGGCCCCAACTATACTGACCCAATTGATCCTGGGTCATTGGCGCTAGATCCGGATGCAATCCAGGCGCAGAT
CCAACCAGATCCAGGTGTACGCTGAAAGGGTGGATCCCGCCCAGATC