Description :
From Genome Similarity Track
Location :
Scaffold_784:271- 4170
Sequence
3899 bases(100 bases per row)
ATGAACATGGCGAGATGACATGAAAACACACTTTTATTATGCCAGCAATTAATAAAGAAGATTACTTAATGACTAAATGCTTTTCTCAGTTCTTTCATGT
GCATACAAGCCTTCGTTTTACGTCTAGAACATCCTAACTCCCGTTTCAGTGCGAAGTATTCAAAAAGGAACCCTTATAACCAGGATCTCACCAGGAGAAG
CATGTTGAAGATGGGGCACGCGGATGTGGGCGAGAGACCGGGCGGTTGCCCTTTTACCCAGGCGGAAAGCCGATCGCTGGACGAGAGGCTCAGCTGGAGG
CGGCGTTGGGATTTCGCTCCAACCAGTTGGCGCGTGGGTCCCGCGCACTCTCTGTTGCGACTGCTTCGATAGACCATCCTGCTCAGCAGACGGTGCCACT
TCATCTTTTGCCAAAACGTACTCTCGAGCCCAGCGACGACGACAAGGAAGTAGACGATAGCTGAGGACAACTGGGCTACATGCTGGGGTGAAGGCTACTT
GCCCTGGGTTTTTGTTCAACGGAAAAAAGAAGAATAGCCGCTCAGAAGCACAGAAGAAAACCCCGAACTGGAGTCTGCACAGAGGTCTCTTTTTAGAACA
TGTGCGTCAGTGCTTCTCCCGCTCGTGCTATTGTTCGAATCTCACCGACACCTTCCGCCTGATGCAGTCCGGGCGATATATATGGTTGCTGTACGTACAT
TGAACCGAACGCGCGCCACATACGCGCATGGCCCGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTATCTCTCTATTCGATGGA
GATGCCCGTTTGAGAAATGCTCGCGGCGCCACCCAAACGTGAGTCAGATGGCACTGGTACATACTCAACTACCTACAACTGCGTGCATGGCTTCGATGTG
CATGCCAGTGCTGCTGTTGTGCTCTCGTTGCCGCCCTGCTGGCCACATGGGCATTCAGGATATTTGAGGAGGTCGAGGCTGTCTCGAGCCTTTAATACAC
AAGCTAATGGTGACGCACCGTTTGCATCAATGTTCTCAACTTGCTGCGCTCCGAGCCTCACATATGCCGCATGTACTGTATGCAGGCAGTTCAGTCAGTC
AGCGCCGTGCTTGACTCACGAGGCAAACGAGCCACGCGCATAGAGTACGTAGAGAGAGCCGACGGCATTCTCGTGATTGCTTTGGGTCAGACGAGGAGGA
GGGAGGGCTCATCATGAACGCACGGTGAGATTCTTAGTCTCGCCTTCCATCATGGGGTCCAGCACCGTGACGCTAACCTCACTCGCGCGAGTGCCACTCT
TGCATCTTATTCGTGCCTTCCCTTTCCTTCGGGTGAGGATGGATGGATGGTTTTGGGGACATGTAAATCACTCTGGGAGAGTGGCTCTGCGTGCTTTCTC
TGGACTCTCCGCTGAATCTATCTTCAAGGTCGTGCGTGGCTTCTACGTGGCACTTCTCCTCCACTCAAAAGCGTAGGTCCTTCCATGACTCACTCGGCGC
TTACGTCAGTTTGCGCATTTGCACGCATGCTGGTTCAAATTTAGCTACATATAGCGAGAGTGGAAACACACGCGTAAATGGAGGAAATTCGATAGTTGCA
CAGCAGAGCACTCACGCGCAAAAGGAAAAGTACACACGTCTAGAATCGCCCATTCTACAAAATACGTTCTACGCATCGCGGACATAAGCGTGTAGTATAG
CGTTTATCCTATAGTATGCGAGTTTAGACCACCAAGTTCAAAGGTACCAGACTATCAAGTTCAAGGGTACCTCTTGTAGGACATCTGCATGCACAAACGC
CCCTTTTTGCACAAACATGGCAGTGTCCTTTTCCTGCGTTGTGGTCAGCGCCCAAAGTGCGTTGCGTCCCACTGCCCAGCGACTTACGGACGCAAGACGG
GGCAGGTGTAGACCAGCGAATTGCGCGTCAGTGTATAGAAATACACGAGCTCCAGCAGTAGCGCGGCTCTGTGGGGGAGATCCGGTTGGTCAGGAGCTCG
TCTCTGCGGTAGAGTGGGAGGTCGGGCTGCTACGTCAGCGCCAACGGTGAAAGCCGCGCTCACGCGCCGCGGGGGAATAAGAATTGAGAGAGTGGCACAT
TTTGTCGCTCGCAAGCGCTGGATTCGCTCGCCTTTGTTTTCAAAAAAACAAACAGGCGCGCTAACGAGGGAAAGATGAAGTTCTCCTGCTTACGCAAGTG
CGCACTGTGCAGCATGCATGCAACGTTGGACGCGGGAATCTTATTCGCTCGAATCAGGCCATCGCCTCCTGCCTGCACGTTCGGACTGAACGAAATTCAC
CTGTTCTACAGGAAAATAATGGCGAGATGCTCGAGTGGGGTTCGCTGCAGCGTCGGCCATGGCGCGAACTGTTCCATTTNNNNNNNNNNNNNNNNNNNNN
NNGTGCACGCAAGCCGGGAACACGTTTTGTGATTTCTTCCATTACCGTCTTGAGATGCTGCTCTATGCGTAATGTGGCTTTCGGACATGCTTTTCGAACA
TTTGATGGCGTCAGGACGCGTGAGTGAGGCACACTCTTCCTGTCCTGCTAAAAAGGGGAAACTCCTTGTCTGGCTGAGGCTGGTTAAATCCGGTGTGAAG
ATGGGGGCCACACGAGGTCCCAAATGTGCGCTGAAGGAGCAAGACAGTGTCACTCTCAGCATGCGAAAAGGATCTTATTCTGGGTAATGATGACACGCGC
CTTTGACGGCCACTCGAACATTTTTTTGCTTTGTGTGCCTCTTGTGTGTTGATAGGTGCAAAAGCAAGTGCCCATCCGACTCCCTTCAGCATGAAGATCG
GATGTCTCTCACCACAGCCACAGAGTCAGCTTTTCACACAATCAATCGTGCCAAAAGCTTCCTTTTCAGTCAGACGGCGACAGGTAGGATGGGTGCTTTT
GCTCACGCCCGCCCTTGCAAACATGCTATGTGTACGTGTCTGTACTGGATGCATGTGACCATGTGGGCGTCACCGCAGTAATCAGCCATAATGATCGTCT
TTACTGTGCTCACGTACTCAACTTTTATGCAAGGGCATCATTCGCCTCCTAATAAAACCACCCTCTGCAGCAACAGACAGTCAGCTTGTGGATATTAGGA
TAGACACATATAATATATGCATGCAGTTGGCCTCTACATGCGTTCATCGTGACGTAAGGAATAAGAATCGGCAGAATGGCCAGAGTTGCCATCTTCAGCC
GCTCGCAAGCGCTTTCATCGATATAGAACGGCAAGCGGGCGAGTCTCAGTGTGATACAGACAGTGCTTAACGTTTTAGCAGTTACCGTGAGGCGCGTGCA
ACGTGGTCACGGTCATCTTAGTCCTCAGAACTCGCTGCTAAAGTCGAACCCACGGTTTGTTCTTAAGATTGGCCCAACGTTCTTTCTTTCTGGTTTGTGA
GAGGCAGCGGCGTGCAACGTGGACGCGAGTCTTAGTCTAATCAAAGCACGCGGCTGAGGTGCCGAAATGCAAGGTTTCGTCTTCGTGCGCATCATTCCTT
CTTTCACGTTCGTGCCTATGAGAAATGGTTCTGCGCTTTTGTTCTTTCGGTCTCCGATTGGATGGCGACGGCCACGCTTCGAAAGCAATGACGTAAGGAA
GGTACCGAAAAGCAAAATCTCAGAGTGTTCCACTCACGAGCGCGTATCTCATCAGGGGGAGGACGCGAAAAAGAGGGGTTTGTGTGCTCGACTGGAGCGT
AAAGACTCTACGGTAGAGTCTCTGGTGGCGGAGGATGGACGCAGAGGCTCGTGGCAAAAGAGCAAGAGAGTGTCACTCGCTTGAAGGTGCCAATCTTAGT
CTGTGGGGAGGAAGCCAGCACCCTCGAGCGTGTGAACCCACCGGCATCCCCACTCGCGCAAGTGAAGAGCGATTTCTTTCCATATACGTTGATCAAATG