Description :
From Genome Similarity Track
Location :
Scaffold_1456:271- 4057
Transcript NameFunction/comments
Phyta_totarag13025hypothetical protein

Sequence
3786 bases(100 bases per row)
TGCCTCGTCACATGGGCcccagtcggggacagcatGAAAAATACCGCGTGAAGCTGCCTACGAAGAGCTTTAGAATAAGGAAGTGGATAAAGTCACACTC
TGGGATCCGGTAATAAAAGCGGTAAATTACTTGTCGCCATTAGATTACAAAAATTTAACTGGCTTCATATTTCTAAAAACACCCCGTCTCCCCCATTCTC
CCATCCCCAACGCCTCAGAGCCGTTCATTTCGAAATCACCGCTAAGAGATCGCAATTTCCGTTAGCAATGGCAGCCGCGGCGTCAGCGGCCTCGGAGCCT
GAGGGCGACGATACACCCGCAGAAGTAAATGCGCCTGAAGCTCATGTTCCTCTATCCGTGGACAAGCGATCCACAGCGCCGTCGATGGAAAAACGGTATT
TTCACAGCTGGGACGCACTTTTTTTAGTATTTGGCAGAATATCAAGACAGGACCCACCAAGTCTTCCGTAAAAGGACGTCTACAACAGCTGAGGCAAAAA
ATAAGACCCTTGCAGTGCGTGGAACACTCACGCCTACAACATAAATCCCATCATCGTTTGAGACGTACTTCCGGCGGCTGACCTGTAGGCATGGATAGTC
GCGAGCTAGCCGGTCTACGGGCAAGCGGGACAACTATTTCATGAAATCGACGAAAAGTGAGGCTCAGCTGTCACTTACAGTAATATGGGCGGTCGAGTTG
GGTTTTCAAGTGAAGGTCACGCAGCAGATAACCGCTCATAACCACACGCTGGGTCGACATACATAAGATAATCACCCCGTCAATCACCGTATCGAAGATC
CCGATGTTATCGatttcgtcgacgagctgcaagcggCAGGATTTTTACGTAGGGACAATACGTTCATGTGGCGAGGTCGATGAAACCTTTTTCGCCCAGG
GGTATAGCGGTAGCCCTTGAAAGTGTTGGTCGAAGACAAGGGACACCAGGACGCAAGGCTCTGGCTTGGCGTGTCACCTCGAGAATCCCTATAGGTCCGT
TCGTCTTTGATNTTTCGCGCACCACCCCCTTATACAGAGGGAAATACAATACACAACCTATACTCTCTTTCCTCAATCGCAGTCTACTCTTCAATCCTGG
AGATGACTGCAACCAATCACCCAAGACGATCTTgttaatatgaaatggaaCACCACCCTTACCTACACGCAATGGGCCCAACTAGGAAATGGAATGCGTG
GATCACTTCAAACGCTCGAGCGAATGATGCCCAACGCAACTGGACTTGAACTTGTGGAGAAGGTCCGCACCGAGGTGTCCTAACGAACGGCGGACCCTTT
GATCCAGGCTGGAAGTCTTCGACTTGTGGGCTAGggggtaaaacgaactctgtttgGTTTTATGCTATCTCTTTCTGTTCTCTGTTTCTGTCTTGTATGA
ACTCTTTGCGTGCTTCCATCATGATTTGTGACATGCTTCTGCGTCTTGACTTGGGTTCAGTATGGAGGACATCTTTGTCATCCCTTGATGTGGGTCTGCT
GGCTGCTCGTGTCTTCGTGCCATTATGTGATGTGTGACTTTTGGCGTTGTTTCTCTGTGTCATCATGTGATGTGTGGTCGTGATAtcttggtttcactat
ggGGGTCATGGCGTCATCATGTGATGTGTGACTTGGGTACTGGATCTTTGCTGGATTCTCGACGTGGGGACGTGTACTGATTTATGCGTCCTGGGGTTAT
CTGCATCCTGGGATGTGCCGGTATCCTGGACGGCACTGCCTTCTAGCAGTGCATCCTGGGCGACCACCATCCTAGCAGTCTGTCTTGTGGCATACTTGAC
TTTCAGTCTCCTGCGTTGTAGCGTACTTGACTCTCATCGTGGGTATTTATCGATGCGTCGTGGGTTACTTGTCTTTCTACCAAGGCACGGACAGGTGTTN
CACAGAGGAATTTCCCCTCGATTGCATCAACCGAATTGACGCAACGATGTCCAGGCCTGCCAGGTTTAACAGCCTCACGCCGCAGATCGGTCCAAACACG
TTAATTCTTAGTCAGCTCACAACCCATCACTCTTTTCTGCGCCCCGTCGCTCCACTTGGTATCCAACGGCCTCCAGGTCGCAAACCAAAATCCAAACTAG
CGCGTCGCCCACGACGCACTCACATCTCGATCAAAACTTCTCGGCCATCTTCACCCGACCAACTCCAGGACGCCGTCATGCCAGGCACGCCTCCTCCAAC
TGCGGACGTCCCCGCGACTGACAATGTTCCCAATGAGTCGAGTGCCAACACTCCGAAGAACTCCAGCgcgcacgacgacgacggtggtggTTCAGAGGCC
AACACCAACGGGCCTGACCAATCGCCTGGCTCTCTAGTTAACGCTGAGGGCAGTGCGGACCGCGAGGATGATGCCAACGATGGCGAGCACACTTCAAAGC
ACGACGACTCCAACCCTGACGGCGGGCCCAAGAAGGACCGGCGCGACGTAAGGGAGGAAGGCGCCCCGGTCCAGAACGCGGGTGCGCATGGTGACTCGCG
AAGCGCGAATCGTCTCCTCGCATCTCTCTCCTTCGAACACTCTTTCGACCGCATTGCTACGCGTGATGACATGGAGGTCCTCAAGAATTCTGGCTGGTCA
ACGAGTCCTCACCCCACGCCGCGTGCAGGCAACGCCCTACTCCGATTGCGTTTGACATTGCCACCTCTCTTCGTGGCTCAAGGAGAGTCCCCTTTGATCG
GCATCCCAGCGACGCAGGCGACGGTCGACAAGAATGTCTTCGTTCACGACGGCTATGGCGGTCCCGAGGCACTATACAGCCACGGGGGTATGACCGCCAC
AGACCTGTACGACATTGAATCGCTCTTAGGTCCGAGCGCGCGTCTCGggctgctgcatcctccTATCACGGTTCCTACGCATGGCGAAGTTGAGGGCGCG
ATGGCTTCCATGCCTGTTCGCCGCGAGCTGGCTTCGCTGCTCACGCAGTATCCTCCTGAAGAGTTGGCTCGGCGCACTTTCAATATGACGACCTACATGC
GTCATCTCTAGGACTTCTACCGCCAAATGTGTGACCAAGTTTCGGCCGCTGGTGCTTCTGTCCAGGACGTAGTGATCACACGGGCGGACCAGGCCGCAGT
CAAGCGCGATTATGCGATCCAAGTCGAGTATTGGCAAAAGAAGGCCGTCGAATtggagctgcgtcttggcgtGGCGGATGAGCGCCACGAGACCGACTTC
CTTGACCTCGCTAgggaggacgaagacgccatGAGCTGCCAGCGTCGATGCGTCGCTACTCTCAAAGAGGAGCTTCGTAACTCGGAGGCTCAGCAGCGTA
TCCTGGAGCGCCGCGTTCGTGAAAACTCAGTCACCAAGCGCGCTCTggtcgacttcttccgccAATACACTAACGTCACCGCGGACTGGGTACGTTTCCA
CGATTTGCTCGGGCATTTCGTGGACAAGACGGTGCCAAATGGTGCCTGGAAGACTCGCATTGAAGTGGATGTGTTTGACGACTACTCGTTTGTACCTCCG
CCATATCCATCGTaggatgacgatgagcaGAAGGACAACGACGCTGACCAGGACATGCCGTCTACAGGACGTGAATCTCTGGTAGACCTCGCTTGAGACG
CACCTAGTCATCACTCCTCCGCTCACGAAGTCTTCGCATCCTGGCGGGAAGTCTCGTTGCCACAGCGCTGAAGACCAGGTTCAAAGTATGCCTACAACGT
ACACCCCTCAGGAACCGGGTGCTCGTCCTGACTCGGAGCCTTTTCAAGCTCTCCAAAGAGCAGGCTCGAGCCGCGCTCCCGGGACC