Description :
From Genome Similarity Track
Location :
scaffold_195:27098- 28278
Transcript NameFunction/comments
Pl_107914hypothetical protein PHYSODRAFT_479774

Sequence
1180 bases(100 bases per row)
GAAGAATCAGACGATTCTTGTCAGTGGAGAGAGTGGTGCTGGTAAGACAGAGACGACCAAGTTTATCATGAATTATTTAGCAGAAAGCAGTCGAGATACT
GTCGTGAGTAGTAACAGGAAGAGGACGATCAGTGGGAGTGAACTCATGAGTGCGAACCCGATCTTGGAGTGTTTTGGCAATGCCAGAACTCTGCGGAACG
ATAACAGTAGTCGCTTTGGAAAGTTTGTGCGCATGTTCTTTGAGGGATATGAACTAGATGCGTCGTTGAGAATGGTGGGCACGTCAGTGGAGACGTATTT
GTTGGAAAAAGTGCGTGTGGTGCATCAGAATGATGGAGAACGGAATTTTCACGTGTTTTACGAGCTGCTTGCTGGTGCAAACGACGAGATGAAGAAGAAG
CTGCATCTTGAGAACTTGTCAGCGCAAGAGTTCCAGTACGTTAATGGAGGGCAGTGTTTTCAGAGAAATGATGGCGTACGTGACGACAAGCAGTTCCAAT
TGGTGCTGCAATCGATGAAAGTCTTGGGATTTACTGATGTTGAACAAGGAGCAATTTGGAAAATCCTGAGTGCGTTATTGCACCTCGGAAACGTGTTGTT
TGTTTCTTCGAGCGAAGATGAGGGAGAGGAAGACAATGGAACAGCGTCGGCTCCATGTAGACTTGCATCTGTCTCGCCATCTTCACTCACAGTGCAGGAG
CATCTCGATATCGTGTCAAAACTGTTTGCTGTGGATCAGGATGAACTGATATCAGCACTGACAACGCGGAAAATCAGTGTTGGTGGTGAAACTTTCCATT
CAAATTTGAGTCTTGCGCAATGTGGAGATGCCCGAGATGCTATGGCTCGTTCGCTCTATGCATTTCTGTTCCAGTTCCTGGTTTCAAAGGTGAACTCAGC
CTCACCACAGGTTCAGAATTCTACGAATCCAGCCAGCATAACAGGAAATACGGATGCACCGACAGGAGGACCATGCATTGCAGTTCTGGATATTTTCGGG
TTTGAAGAGTTTGACATCAATCAGTTTGAGCAGTTCTGCATTAACTATGCAAACGAAAAATTGCAGTACCAGTTCATCCAAGATATTCTTTTGACGGAGC
AACAGGCACATATCGAGGAGGGGATTAAATGGAATGCTGTGGACTACGAGGACAATTCCAATTGTTTGGAAATGGTTGAG