Description :
From Genome Similarity Track
Location :
Scaffold_8:270942- 272355
Transcript NameFunction/comments
Physo_129543hypothetical protein

Sequence
1413 bases(100 bases per row)
TGTAATGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGCGCACACGTGTGTGAGGAAGCGTAGCGTAGTTTAAACTAGAGTTAATTATACTCGGGA
CTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTGGGTTATAATGAGAACTGCTATTCTTGTTTTATGTTTCTGACTTCCTCTAAATGT
AATATTCTAAAATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAA
TCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAG
ACGTCGTGTCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCAC
GTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTTATTCCGCAATGAGCTTGCCTCAGAAGAATACCGACACTG
CAGCAGAGGGGAAGTCCTCCGCCGGGATAGAGACTCTCTCTATCCCCGAGTACCGCGAGCGTCTCAAAGCAAAGCGTGACGCTCTTGCTACCAAGGCTGC
GGCGGGGACAACTTAACCAGAGATTGCCCTCGAAGGTTCTGCTGCAGTCGACGACGCCGTTGACTTCGACGACGACGTGGAGATGGAAGAGGGCGAGGCC
TCTTCTAGCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCT
CGAAGCGTTCGCGCGGCGAGAGCGACACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCACGTGATGTGGTGACTTCAAGTTCTCCGCGCGCTGCTCA
GGCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCTGACCGCGTGGGCAACACTGTGCCTCCAAACGAAATTCCGCTGTACGTATGCAGCGGT
ATCCGCGACGATGCTGTTGCGGAGGCGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGATTATTACATCGGGCTCTTCCACGAGCTCTGGTACTTCT
CCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGC
TTACCGCGAGCGGGTTAAGCATGCCCGTAAACGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATT
CCATGCGCTGTGC