Description :
From Genome Similarity Track
Location :
Scaffold_444:2709- 6216
Sequence
3507 bases(100 bases per row)
GGGAAACGTCGACTCCCAGTAGGCGCGTGGCTCCCTACTGGGGAGAAAATGGGCTTTGTAGAGGCTCTAGGAGGTAGAGCTAAACAGGGCTTAGCACCTC
ACGATCTCGTGGACGTTGCCACGAAACGTGAATACAAGTCAGGCTTGTTGGTTGTCTCGGCAACGGTTAAGGGCATTGAAGAGCTGTGGTCAATTTTGAT
TGACTCTGAGGCACCGGGCAACTACTTTCGACGCCAACCTTGAGAAGGAATTCAGCAGTAAGCTGAAGCGCTGAAAGCGTACGAAGGTGATGTTATCAGG
GTGCTCCTAGCAACGGGGGTCCGTGTCACTGTACCTAACATTCTGTTGAACTTAGGTGTTGAGGTTTTAGACTTTAAAAGCATTGAACGTAGTCTTGTCC
CAGATTTGAACTCGAGATTTGATCTGATTCTCGGCATGGTCTGGCTGGAAAGCCACGAGCCATGGATTGATAGGAGGTCCAAGTCCTTAGGCGCAACGCG
CAATGTTTCTAGTAAAGCGTTGGAGAGTCATGAAACCACCTTTGCTAGACAGCAAAAGCGCTATTGGCGCGAGCCACTGACTGAGTCAATTAGTGTTCTG
GATATCGGAATGTCTGAGTTAGTTGACTCTTATGTCAATGACAATAGTGAGACGGCACATACTCCGTTGGGTAGCACTTGTTGTTACAAAGAGCCACTGG
ATGCTGATAGCATTGATGACCCCAGGTCAATTCATTTAGGGTGCGATCCCTTAGATATATGTGCAGTGGCACGTGAACATCCACAGAGTGAGGGCGACTG
CAATAGCATCTCAGTGAATGCCGGTAATGGTGTTGTTGGCGAGACGCCCAGACATCAAGCGTCTGATGTGGGTACAGTAGCGAATAACTCGCCGGGTGAT
GAGTTCGAGTCAATAAACTCTGCACCTGATGCTGGTAATAATATCAGCTCTTGTTTCGAGCACGCTAAGGTTGATAAAGCTTATCATCTTGTAGGACCAG
ACGGTCCGCCCTCGCTGAGGAGTTCAGTCCTTTTTTAGAGACGGCAGCGACGCCAAATGGTGGCTGCAAGACGGAAAGCGTCTGTAATGTCGCTTAGCGA
TACTAGCGATCATCTATATACATTGGTCGATGGCGTGACAGGTCACGTGGATGGTGAAGTTGGCCTTGCGGCCCTGCCATCGTTAACTGCTCTGTTAGAG
CTAGACGAAATGTCTGTAGACGAGTTCAGTCAGGCCTTGAAGGCAGGCAACTAATACAATATGGTGACCCTTAGACCCGATAATGAGTTGAACTCCTCGT
CTCTATTAGACGAGGCGGTCCTTGAAAGAACAAAGGCGGCACTTAGTGCTTGAAGTGGATCATCTATTTTAAAGAGCCCTTCAGATCCCTATTATCCTTT
GGCTAAGGAATTTCAAGACGTGGTTTATCATAATGCACCGTCTGTATTACCTCCCGATAGGGGCGTACTTCATGAAATTGACTTCGTTCGTGGAACCAAA
TACTGCGTTACAAGACACTGGCATTTACCAAAGGAACAATGTGATGTCATTGACGAGTTTTTCAGTGATAAGCACGCGGCGGGAATGGTGCGGGAGAGCA
AGTCTCCTCATTCCACACCGACGTTTTGTGTCAAAAAAACTAATGGTAAGTGGCGTATTGTGCACGCTAATACTAAGCTTAATGCGGCCACTATACCGGC
ACAAACACCCATTCCTAGAAAGGACGTTCTTCAGAACAACATGGCAGGATGTAAAATGTACAGTGAACTCTATTTGGTCGATTGGTATTATAAATTGCTC
ATGCGAGCAAGTGATATCCCGCTTACAGCGGTTAGTACTACAAGCGGTATGCTTTGGAAGTGGCTGGTTATGCCACAAGGACTATCCAATGCCTCGGATA
CATTTAATCGTCTGGTGACGCAATTGTTCCGCCCTCACCGTGCGTATGCACAAACATATTTCAATGATATATTTTTTCATAGTCATCCGGAACAGGTTCA
TTCGGACGCGGATAACCAAATCGACCATTTACGAGCTGTGCTTAAATGCATGCGGACTAATAAGCTCTATGATAATGCACCAAAATGTATCTTTAGTGCA
AATAAGATTGCACTTTTGTGATGCTTCATTGGAAAGCGAGGCCTTCGGGCAGATTATGGAAAGGTGAAGGCCATAGTGGATTGGCCAGTTCATAAGAATT
AAAAGGACCAACGCAGATGGCTTAGCCTTTCCAATTACTTGCACAAGTATAGCGATAATTACGCTGATATGGCTCGGCCATCATCCAATCTCCTTAAGAA
GGATGTGGAGTGGTGCTGGACTAGCACCGAAGCAGAAACTTTAAGGTCGTAACGGAGAGTCTCCTACATGCCCCAATTTTGGCTTTGCCAGATTCTGATC
GGCCTTTTAGTGTCGTCTGTGACGCTTCGGATTTTGCCTTTGGCTGTGCTCTGTTACAAACAGATTTTGAGGGACGCGATCGTGTCATTGCGTTCAATCC
CGTCAGCTTAAAGCTGCTGAAACGAATCATCCGGTCCACGACAACGAGCCGCTTGCTATGAAGTATGCTCTAGTCAAACTCAGAGTTATCTGCTTGGCTC
TATGCCTTTTGTAGTCTATACCGATCATGCGTCTTTACGCACGGCGACCCAATCGCCTCACCTCTCGCAGAAGATGGCCCGTTGGCTTTCATTCTTTGCA
GAATATAAGTTCGAGGTGAAGTATAAGCCGGGAAAGCAAAATACGCTGGTTGATACGCTGTCACGACGGCCCGAATATGAGCTTGCTCATGCTACGATTT
TTTCATCGTCAATTTCTGACTTAATCCGTGCATCTTATGCCATAGATGAAAAATGTGTAGCTTTGCTACGTGCTCTTGGAAGCGATGAGTTTAACGACTC
GGACATTAAATTGTCGGCACGTTCGCATGCGAGGCTACATCGATATTCTATCGATAAAGGCTTGTTGTGCTATCGCACGGATGCTGTGGATACCCCGCGT
ATCATTGTTCCTCATGATGAGGAACTGAAGTATCGCATCCTCTATGAGGTGGACGACACTGCTATTAGCGGTCATCTCGGTCGTTAGAAGACCTACGGAT
TAGTAAGCCAGAGTTATTGGTAGCCCGAACTCTATAAATGGGTAAGCACTTATGTGCGCACATGTGAGACGTGCCAACAGGTCAAACCCTCGGCACATGT
GACAGCGCCTCTGGCTAGTTTGCCTGTATCCTCTGGGCGTCGGGAGTCCATCAGCATGGACTTTGGGTTTATCCTACCGAAGGATTCGGAGGGAAACACA
GGTATTGTGGTCTTTGTCGACCGTTTGAGCAAAATTGCTCACTTGGCGGCTGTGTTGGATTCGATTGATGGTGAAGGTACAGGTTTGCTGTTTATTGATC
GTGTGCTTCGACAACACGGCCTGCCACTGGCATTTGTCTCTGACCGCAATTCTCGTTTTACGGGCAAGTTCTGGAAGGCCATCTTCAAGTTGCTCACGCA
ATGGCTG